Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL517h20ex.5                         45 PI      88          1      993                (no blast hit)

 This cluster: approximate FL confidence score = 64%

 1012771505 Xl3.1-IMAGE:6636403.5 - 18 ESTs
                                                                       .....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6636403.5      TCACAGTGTCCTCTTGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGAAAAAAATTCAAAAACATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAAAATTGTGCAAAGGCAAGAGTTTTTCTT
                                                  Xl3.1-CHK-1012690585            TGTCCTCTTGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGAAAAAAATTCAAAAACATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAAAATTGTGCAAAGGCAAGAGTTTTTCTTTTTTTT
                                                      consensus depths           2     2     3     5     6     7     7     8     8     9     9    10     9    10     9    10    10    11    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    14    12    14    12    15    12    15    13    15    13    15    13    15    13    15    13    15    13    15    13    15    14    16    13    16    14    16    14    16    15    16    14    16    14    16    14    16    14    16    14    16    14    16    15    16    15    16    15    16    15    16    15    16    15    16    14    16    14    16    14    16    14    16    13    16    13    15    13    15    11    15    13    15    13    14    12    14    11    14     9    13     8    13     6    10     4     8     4     8     4     8     4     8     4     8     4     8     3     7     4     8     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     5     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                               BLH MIN      13      89      
                                               BLH MPR       1      89      
                                               BLH OVR      37      47      
                                               EST CLI       4      30      
                                               ORF LNG      37       3      
  5   1   2       bld FaBN 5g                         IMAGE:8077995.5p GGGTGTCACAGTGTCCTCTTGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCNTTATGACACTTGATGGATTTTTGGCTGAACGTNAGTGGGATATACTTT
  5   1   2       bld Tbd3 5g                         IMAGE:3549162.5p      TCACAGTGTCCTCTTGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGTTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAAGTCTAATAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTGTCACTATCCCGGAGGTTAGCTTTCAACCA
  5   1   2       bld Emb4 5g                         IMAGE:5542722.5p               GGACGCGTGGGATACACGTGGGCACTTCCAGGACCATGTTCTCCACTTTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTTGATGGATTTTTTGGCTGACCCGTGGAGTGGGATAATACTTTTTGCTGATGAGCTAGTGGGAACTCAGCACTGCTTTTGGAACACCATGAAATACATCAAGTTTTCTAGAAAAATCTTAAAAGAACTTTGCCA
  5   1   2       bld Tad1      in                    IMAGE:6878516.5p                 GGGGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTNCACCCACAGGAGACACAGAATGGAAGGGAGACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGGATAA
  5   1   2       bld Tad1 5g                         IMAGE:6938149.5p                  GGGGTCACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATTAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGGACTTGGGGAAGAAGAGGAAGAAAGTGACATTTTTCCTATCCGGGGAGTTAGCTTTCCACCCACAGGGAACACCGAATGGGAAGGAAAACCGCCTATACTCTTAACACTGGATTCCCTTGACTGGGGCCCTTTTATGAACACTTGAATGGAATTTTTCGGCTGAA
  5   1   2       bld Te1  5g                         IMAGE:6929953.5p                     GGGACATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAAGTTAGCTTTCAACCCACAGGAGACACAGAATGGGAAGAGAACAGCTATACTCTTTACACTGATTCACTTTGACGGGGCCCTTTATGACCACTTGATGG
  5   1   2       bld Spl  5g                         IMAGE:8463602.5p                        CCATACACGTGGGCACTTCCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTTCACCCACAGGAGACACAGAATGGAAAGAGAACAGCTATACTCTTAACACTGATTCA
  5   1   2       bld Ga15 5g                            XL430c11ex.5p                                          CCAGGACCATGTTCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGAT
  5   1   2      seed Emb1                            IMAGE:6636403.5p                                                      TCTCCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTC
  5   1   2       bld Brn3                            IMAGE:8539031.5p                                                         CCACTCTGTCCCGAGTTCTCTTCTCCGCCACACGAGTAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGGATGGAAGGAGAACAGCTATACTCTCAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTGGCTGAACGTGGAGTGGATATACTTTTGCTGATGAGCTAGTGAACTCAGCACTGCTTTTGAAACATGATACTCAAGTTCTAGAAACTAANGACTTGCAATGCTAGACTTTTCATCCTTTCTTCGAGCTT
  5   1   2       bld Emb1                   IMAGE:6633908-IMAGp.IMAGp                                                                                             TAGCGACAGTACGGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGG
  5   1   2       bld Brn1                            IMAGE:6953676.5p                                                                                                         GGCCCCAACAGCTGCTGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAAAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAAAACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCTTGGAGTGGATAATACTTTTGGCTGATGAGCCAGTGGAAATCCGCACTGCTTTGGGAACACCCATGGATACCATCGAGGTTTCTAGAAAAATCTTAAAAAACTTTTGCCAAATGGCTAAAGAATTTTTTTCAATTCAGTTTTCCTTACTCAAAAGACCTGGTATCCCATAAAGTAGGGTTCCGTGGAGGGCAAAGGTCAACCGAAGTTTGTAAGCGAGAAACCAATGAGGGGGTGGGTGAAAATATGAAAACTGAAAATTTAACAAATGTGATGGCGACAAGGGGGCAAATCAG
  5   1   2       bld Tad2                            IMAGE:6933124.5p                                                                                                                       GGGAGCTCCTTGTGCGCCGCACGTTCCTTCTCACGCTCATTATGTTTGGTCGGTGGGAACCCTGGGCTCAGGCAGAACTTTCTACATCCTCAACGCGGTTTCCCAGCCGTATCTTGTGGTTGCGGGGGGCTGCACACTGAGGGTGACAAGGCTCTTGCTGAATTTCTGAAGGATGAAATCAAAGAAGAGaaaaaaattcaaaaaCATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTTGATGGATTTTTTTGGGCTGACCCGTGGGAGTGGATAAATAACTTTTGGCTGGATGAAGCTAAGTGGGAACTCCACCCCCTGCCTTTTTGGAACCCCCCATGGAAATACATTCCAAGGTTTTCCTaaaaaaaatccttaaaaggaattttggtctcaaaatggctaaagaaaaattttttttCAAATTCCCCTTTTGTCTCTTTTTCCAAAGAAGGGCTGTGTATATCCCCCTGAAAATAAAGGGCCTC
  3   1   2       chi Tad1      in                    IMAGE:6878516.3p                                                                                                                                                                                                                                                              ACTCCTCGCTTAAATTTGCCGAAAGGATTGAAATTCCAAGGAAGTGGAACAAAAATTCCAAACAACTTTAGGAACCTTCTTAAAAAATTTCTGGTGGATGGGAAATTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTTTGGTGAAACGATTACAGTCACTTTCAACACTAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAAAATTGTGCAAAGGCAAGAGTTTCTTTTTTTTTTACATTCTGTGCAGTCACTGATCTACAAAAGGTCAGTTTGTAGAAAACCAATATCCTACATAACACATATGGTATCTGGTTTATTTATATAACAATACTTGTGTAAACTCTATATGTAAACNNNTTTTTTTTTTTTTNGCTAATATAAGGCTTTATCTGTTAAATAACAGATAAAGCCTCAGAT
  5  -1   2       add Emb1                            IMAGE:6633908.5p                                                                                                                                                                                                                                                                                         TGGGGTGCAATGGGCCTCTTGGAGGGTTAAGGGCCCGCGGGGGTTATATCGTGGGCGGGGAGAAAATTTTCTGTGTGAAACCGGATTTCCAGTCCCCTTTTCAACCCCAAATTAATAAGCCTTGCCGCCCCAGGTTTTAATTGGGGGAGccccccccAAAAGGTCCCAAAGGCCAGGGGGGAGAAATGGACCCCTGAGCGTTGGTGTTTACCTGCCCCCATTTTTGGGGGGAGGAAGTTTCTAAAAAAGGGGATGGCCGAGCCCAGGCCCCGGGTTTCTTGGGCGGGTCCGCTATCCCAGAAGAATGAGGTATGGACCATGGGGGAGGAAGAGGGAAGAAAAGTGACATTTTCCCTATCCGGGAGGGTTAGCTTTCAACCCACAGGGAGCGCAAAAGGAAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCCCTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGGGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAACATTGTGCAAAGGCAAGAGttttttttttttACATTCTGTGCAGTCACTGATCTACAAAAGGTCAGTTTGTAGAAAACCAATATCCTACATAACACATATGGTATCTGGTTTATTTATATAACAATACTTGTGTAAACTCATATGTAAACtttttttttttttttttgctaatataaggctttatctgtcttttttttaataaatatctttcagaaatcactct
  3   1   2       bld FaB                             IMAGE:8070506.3p                                                                                                                                                                                                                                                                                                                                                                                             TAAACTGGGTCAGAAAAAATTTTTGGTGAAACGATACAGTCACTTTCAACACAAATAATAGCATTCCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCATGTGTCTACTCCCAATTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAAAATTGTGCAAAGGCAAGAGTTTTTCTTTTTTTTTACATTCTGTGCAGTCACTGATCTACAAAAGGTCAGTTTGTAGAAAACCAAAATCCTCCATAACACATATGGTATCTGGTTTATTTATATAACAATACTTGTGTAAACTCATATGTAAACTTTTTTTTTTTTTTTTGCTAATATAAGGCATTATCTGTTATATACAGAAAAC
  5   1   1       add Ga15                               XL485n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGTCAAATGCTAAGACATTTTTCAATCACTTTCTTTTCAGAGGCTGTATCCTGAGTAGGCTCTTGTTGCATGTCATCTAGTTTAGCTGACATATGGGGTGTTAAATCAGACAGATTTAAAATTGTGCAACGGCAAGAGtttttctttttttttttttACATNC
  5   1   0       add Emb1                            IMAGE:6630856.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGGTCAGTTTGTAGAAAACCAATATCCTACATAACACATATGGTATCTGGTTTATTTATATAACAATACTTGTGTAAACTCATATGTAAACttttttttttttGCTAATATAAGGCTTTATCTGTTATTTTTTTAATAAATATCTTTCAGAAATCACTCTAATTTCNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)