Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL170l20.3                           13 END     8          53       61                (no blast hit)

 This cluster: approximate FL confidence score = 77%
Application error: Error while executing statement.
22001 [Microsoft][ODBC SQL Server Driver][SQL Server]String or binary data would be truncated.

Use your browser's 'Back <==' button to return to the previous page, where you may be able to correct the problem.
There may be more error messages further down this page - print, save, or cut&paste these messages if you want to pass them on.
1012771510 Xl3.1-IMAGE:4032122.5 - 15 ESTs .-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180 ? ? ? ? ? ? ? ? Xl3.1-IMAGE:4032122.5 AAGCAGCAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCAACTGACTGTAGGGTCAAGCCTTTCCATACGCATCGTGGGCTATAAATCTGTTACAGAGGAGAAAGTAAAAAAGACCTGGACTCACATTGATGCCAAAACACACAAAAAGGAAGACATAAAAAAGGAAACAGTTTACTGTCTGAATAACGATGAAGAGACCGAAGTGGAAAAGGACGATACCATTCAAGGTTTCCGTTATGGGAGTGACATTGTGCCCTTCTCAAAGGTTGATCAGGAACAGATGAAATACAAATCAGAAGGGAA Xl3.1-CHK-1012691815 CAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCAACTGACTGTAGGGTCAAGCCTTTCCATACGCATCGTGGGCTATAAATCTGTTACAGAGGAGAAAGTAAAAAAGACCTGGACTCACATTGATGCCAAAACACACAAAAAGGAAGACATAAAAAAGGAAACAGTTTACTGTCTGAATAACGATGAAGAGACCGAAGTGGAAAAGGACGATACCATTCAAGGTTTCCGTTATGGGAGTGACATTGTGCCCTTCTCAAAGGTTGATCAGGAACAGATGAAATACAAATCAGAAGGGAAGTGTAT consensus depths 3 5 6 8 12 12 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 11 12 11 12 11 12 9 11 10 11 9 10 9 10 9 10 8 9 7 9 6 9 8 11 8 11 6 9 6 9 6 9 5 9 5 9 5 8 5 8 5 8 4 7 4 6 4 5 4 5 4 5 3 4 3 4 3 4 3 4 3 4 3 4 3 4 3 4 3 4 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 BLH ATG 10 197 PROTEIN --- Dm ==== 3e-007 NP_609767.2 Ku80 CG18801-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN --- At ==== 1e-018 NP_564520.1 ATKU80/KU80 (Arabidopsis thaliana Ku80 homolog); double-stranded DNA binding / protein binding ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================ PROTEIN === Ag ==== 2e-019 XP_319031.4 AGAP009910-PA [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN --- ?? ---- 1e-027 XP_637846.1 ATP-dependent DNA helicase [Dictyostelium discoideum AX4] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Ci ==== 3e-055 NP_001122374.1 zinc finger protein ZF(C2H2)-102 [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================ PREDICTED = Sp ==== 1e-054 XP_001183105.1 PREDICTED: similar to ATP-dependent DNA helicase 2 subunit 2 (ATP-dependent DNA helicase II 80 kDa subunit) (Lupus Ku autoantigen protein p86) (Ku86) (Ku80) (86 kDa subunit of Ku antigen) (Thyroid-lupus autoantigen) (TLAA) (CTC box-binding factor 85 kDa su ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN --- Hs ---= 1e-125 NP_066964.1 ATP-dependent DNA helicase II [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED - Cf ---- 2e-127 XP_536061.2 PREDICTED: similar to ATP-dependent DNA helicase II [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN --- Mm ---= 5e-128 NP_033559.2 X-ray repair complementing defective repair in Chinese hamster cells 5 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED - Gg ---- 3e-128 XP_422072.2 PREDICTED: similar to Ku (p70/p80) protein [Gallus gallus] ------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Bt ==== 1e-128 NP_001095611.1 ATP-dependent DNA helicase II [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PREDICTED = Dr ==== 9e-132 XP_001918508.1 PREDICTED: hypothetical protein [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Xl ==== 0 NP_001081127.1 X-ray repair complementing defective repair in Chinese hamster cells 5 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== Xl3.1-IMAGE:4032122.5 ATG---------------------------------ATG---------------ATG---------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG ORF ... open reading frame ... 5 1 2 bld Oo1 5g IMAGE:3404105-IMAGp.IMAGp GAAAAAGCAGGGGCTTGGGACCGGTCCCGCAATTCCCGGGATCAGCAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATG 5 1 2 bld FaB 5g IMAGE:8072921.5p CAGAAAGCCCGGAAGCAGCAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACTTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTCATTTAGGGATAGTCTAGAGAGGCTGAGCAT 5 1 2 bld Emb9 5g IMAGE:7976093.5p GAAGCCCGGAAGCAGCAAGATGGCGCGAGCATGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCACaaaaaaaaTGCATTGAGATGGTGAAGAAGATCATGTTCTCTCTGGACGGGGAGAATGACTAAGTGAAGTTTTTCATTAGGGATAGTCTAAGAGCCGAGCATTTCAGAAATCGAAGGAGCCATCCATGGCATGCCAATGATGGAGGCAGCCTTCTACCATCGGGGTAAATTGT 5 1 2 bld Ga18 out xlk143a18ex.5p AAAGNCCGGAAGCAGCAAGATGGCNNNNNGNCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGNTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTNCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGNTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGNNTCCAGTAATAACAGAGGGAATGCAGNCAGNTCGGACAGAGGGTGTGGCCCTGGGAAANNNTCTCTGATCAACAGAAAGAAGGCANTGAGATGGGATAGTCTAGAGAGGCTGAGNATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCNAACTGACTGTAGGGNCAAGCCTTTCCNTACGCATCGNGGGCTNNAAATCTGTNCAGAGNGNAAGNAAAAANAC 5 1 2 bld Kid 5g IMAGE:4032122.5p AAGCAGCAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGNGAAGAAGGACTAAGTGAAGTTTTTACATTTANGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCAACTGACTGTANGGTCAAGCCTTTCCATACGCATCGTGGGCTATAAATCTGNTACAGAGGAGAAAGTAAAAAAGACCTGGACTCACATTGATGCCAAAACACNCAAAAAGGAAGACATAAAAAAGGGAACAGTTTACTGTCTGAATAACGATGNAAGAGA 5 1 2 bld Te2N 5g IMAGE:7203905.5p CAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTTCAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCNACTGACTGTAGGGTCAAGCTTTTTCATACGCATCGTGGGCTATAAATCTGTTTACAGAGGAGAAAGTAAAAAAGAACCTGAACTCACATTGAATGCCaaaacacacaaaaaaggaggacntaaaaaaagaaaaCGAGTTTACTGGTTCTGAAATACGAAT 5 1 2 bld Te2N 5g3 out IMAGE:7764884.5p CAAGATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGGAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAAGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAAGGCTATGCCATGGCC 5 1 2 bld Neu7 5g XL030p24.5p ATGGCGCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCC 5 1 2 bld Te2N IMAGE:7768823.5p GCGAGCAGCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAAAGAAAGAGGCATTGAGATGGTGAGGAAATCATGTCTCTCTGGAGGGGAAGAAGACTAGTGAGTTTTTTCTTAGGATAGTCANAAGCTGACATTTCAGAGATCAGAGAGGCATGCCTGCCATGCACGATGAGGTCAGCCTTATAGCTCGGGTAAATCGTACAAGAAGTAAAACTGCTCCTGATCAACCCAAGGAATAAAGAATTTTG 5 1 2 bld Neu7 out XL048k11.5p GGCCAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTNATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGAC 5 1 2 bld Ga12 out XL220j08.5p GCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACNTCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGG 5 1 2 seed DMZ out xl335i19.5p GCCAAAAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTTCTGCCTTTCTCTGTTGATGAAGAAGAGTTTGGAGGTTCCAGTAATAACAGAGGGAATGCAGGCAGTTCGGACAGAGGGTGTGGCCCTGGGAAAGGGCTCTCTGATCAACAGAAAGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGG 5 1 2 chi Tbd7 out XL106k22.5p AAGTGCCGTGGTGCTGTGTATGGACGTGGGACTCGCAATGAGCCATTCCAACCAAGGCAAGGAGTCTCCGTTTGAGCAAGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAAAGCAAGGATGAGATTGCAGTGGTTCTGTATGGCACGGACACCACAGATAATGCCCTGGCTCGTGAAGATCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTTCTAGAACAAATAGAGAATGTAGTTGAGCCAGGCTCTGTGCAAGCTGATTTTCTTGATGCTCTGATTGTATCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACACGCGACTGCACATTGCAGTATTCTCTGATCTCAGCAGCCCCTTCAGTGTGGACCAACTTGAGGTTATTATCGCGAACCTTAAAAAAGCTGAAATCACCCTTCAGTTCTTGTAAGTGCTGCCATTTCATTCTTACCGACTAAGAAGCTGCAATATTGTATGCACCTGTGCAGTTTTTGGCTGTATGTGGCTTTCCTTGTATGAAACAGGC 5 1 2 bld Egg4 out IMAGE:3743379.5p CATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCAACTGACTGTAGGGTCAAGCCTTTCCATACGCATCGTGGGCTATAAATCTGTTACAGAGGAGAAAGTAAAAAAGACCTGGACTCACATTGATGCCATAACACACAAAAAGGAAGACATAAAAAAGGAAACAGTTTACTGTCTGAATAACGATGAAGAGACCGAAGTGGAAAAGGACGATACCATTCAAGGTTTCCGTTATGGGAGTGACATTGTGCCCTTCTCAAATGTTGATCAGGAACAGATGAAATACAAATCAGAAGGGAAGTGTATTGCAGTTCTGGTATTC 5 1 2 bld Ooc2 out IMAGE:3745731.5p CATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGAAGGACTAAGTGAAGTTTTTACATTTAGGGATAGTCTAGAGAGGCTGAGCATTTTCAAGAAGATCGAGAGGAGGCCTATGCCATGGCCATGCCAACTGACTGTAGGGTCAAGCCTTTCCATACGCATCGTGGGCTATAAATCTGTTACAGAGGAGAAAGTAAAAAAGACCTGGACTCACATTGATGCCaaaacacacaaaaaggaagacataaaaaaggaaacaGTTTACTGTCTGAATAACGATGAAGAGACCGAAGTGGAAAAGGACGATACCATTCAAGGTTTCCGTTATGGGAGTGACATTGTGCCCTTCTCAAAGGTTGATCANGAACAGATGAAATACAAATCAGAAGGGAAGTGTNTTGCAGTTCTGGGATTCACTAAATCATCCATGGTGCTGAGTAACCAGTTTGTGGGAAATCACGTGATCAGGATGTTTGCTCCCTCTGATGACGAGGCTGCCAGTGTGGCCCTCTCGGCTCTGATTCATGCCTTGGATGAGATGGATATGTTGGCATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)