Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-xl286g19.5                            5 END     2           7       40                ACTN1 protein [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:8527291.5                       3 END     1           3       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk136p21ex.3.5                      97 PI      73         27      828                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8637853.5                      65 PI      76         12      410                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8546546.5                      22 PI      92          1     1080                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8641719.5                      22 PI      81        195      410                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:8527291.5                       3 PI      93          1      148                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012771572 Xl3.1-IMAGE:8641040.3 - 28 ESTs
                                                                       .........-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8641040.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGCACTTACAGAGGAACACGCCCGACAGCAGCAGAATGAGCGACTGCGGAAACAGTTTGCTGCACAGGCCAATGTCATTGGACCATGGATACAAACAAAGATGCAGGAGATTGGACGCATTGCTATAGAAATGCATGGTACCCTGGAGGACCAACTGAATCATCTGCGGCAGTATGAGAAAAGCATTGTAAACTACAAACCAAAGATTGACCAGTTAGAAAGTGATCACCAACAGATTCAGGAAGCACTTATCTTTGACAACAAACACACCAACTACACCATGGAGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCGATGATGTATTTTTCTGCCAACAAAAAAAAAAAATACCCCAAGGTGAAATGAATGCTTTGTGGTAAAGTTGTTCCGGCGCCTTGTTTATGTTGCGTATCCTTTGGTTACGGCATTATGGAGATCTTAACAGGTTTAGCATGAGTTACTCGCCTCACCTTATTTTCCTTTTAAAAAAACAAATGCATTTTTATTTTTTTTTTATATATATAAATATATTTTTGTGGCAAATTGGCAAGATAGAGCTGTGGTGTCCAACCTGTGAACCCCTCTACAGCTGCCGTTGAACTAAATGATCCAGCCAACGCCTGTGAGAGGAGGATGGTTACAGTACGGATATCCCAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTATTTTTTTTGTTTGGAAATATGAAGCTTAAATAATTTGTTCTCAATATTGCTTTTCACGGGCCATATTAAAGAAGTTCTTG
                                                  Xl3.1-CHK-1012688297                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTACAGAGGAACACGCCCGACAGCAGCAGAATGAGCGACTGCGGAAACAGTTTGCTGCACAGGCCAATGTCATTGGACCATGGATACAAACAAAGATGCAGGAGATTGGACGCATTGCTATAGAAATGCATGGTACCCTGGAGGACCAACTGAATCATCTGCGGCAGTATGAGAAAAGCATTGTAAACTACAAACCAAAGATTGACCAGTTAGAAAGTGATCACCAACAGATTCAGGAAGCACTTATCTTTGACAACAAACACACCAACTACACCATGGAGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCGATGATGTATTTTTCTGCCAACAAAAAAAAAAAATACCCCAAGGTGAAATGAATGCTTTGTGGTAAAGTTGTTCCGGCGCCTTGTTTATGTTGCGTATCCTTTGGTTACGGCATTATGGAGATCTTAACAGGTTTAGCATGAGTTACTCGCCTCACCTTATTTTCCTTTTAAAAAAACAAATGCATTTTTATTTTTTTTTTATATATATAAATATATTTTTGTGGCAAATTGGCAAGATAGAGCTGTGGTGTCCAACCTGTGAACCCCTCTACAGCTGCCGTTGAACTAAATGATCCAGCCAACGCCTGTGAGAGGAGGATGGTTACAGTACGGATATCCCAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTATTTTTTTTGTTTGGAAATATGAAGCTTAAATAATTTGTTCTCAATATTGCTTTTCACGGGCCATATTAAAGAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     2     2     2     2     2     2     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     6     6     9     5    10     5    10     6    10     5     9     7    11     7    11     7    11     9    12     9    12     9    12    10    13    10    13    10    13    10    13    12    15    13    15    12    15    12    16    14    16    14    16    14    16    15    16    14    16    15    16    14    16    15    16    16    16    17    17    17    18    17    20    18    20    20    21    20    21    19    21    19    21    19    21    18    21    20    21    20    21    20    21    19    21    20    21    19    20    19    19    18    19    19    19    19    19    19    19    18    18    17    19    14    19    13    19    15    20    16    20    15    20    15    20    15    20    14    20    14    20    12    20     7    19     7    16     7    15     4    11     3     8     3     5     2     4     2     4     2     4     2     4     2     4     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     5     3     5     3     5     2     4     2     4     2     3
  5   1   2       bld Ga18      in                      xlk149p04ex.5p GATATCAAAGCTCTTCTGAAGAAACATGAGGCCTTTGAAAGTGACTTGGCTGCCCACCAAGACAGAGTGGAANAGATTGCAGCAATAGCGCAGGANCTTAATGAGCTGGACTACTATGACTCGCCAAGTGTTAATGACAGGTGCCAAAGAATCTGTGATGAGTGGGATAACCTTGGAGCTCTAACACAGAAACGAAGGGACGCTTTGGAGAGAACTGAGAAGTTGCTAGAAACTATTGATCAGCTGTACTTAGAGTATGCCAAGCGAGCTGCCCCCTTCAACAATTGGATGGAAGGAGCAATGGAAGACTTGCAGGACACTTTCATTGTCCATACCATAGAGGAGATCCAGGGATTAACCACAGCACATGAGCAGTTCAAGGCAACATTACCTGAGGCTGACAAGGAGCGCCNNNNATCTTAGGAATTCAGAATGAGATTTCTAAGATCATGCAGACCTATCATGTCAATATGTCTGGCTCAAACCCCTATACCAGCATTACACCTCAAGAAATCAACAACAAATGGGACCATGTCAGACAGCTGGTCCCCCGTCGNNTCAGGCACTTACAGAGGAACACGCCCGACAGCAGCAGAATGAGCGACTGCGGAAACAGTTTGCTGCACAGGCCAATGTCATTGGACCATGGATACAAACAAAGATGCAGGAGANTGGACGCATTGCTATAGAAATGCATGGTACCCTGGAGGANCAACTGAATCATCTGCGGCAGTATGAGAAAAGCATTGTAAACTACAAACCAAAGATTGANCAGTTAGAAAGTGATCACCAACAGATTCAGGAAGCACTTATCTTTGACAACAAACACACCAACTACACCATGGAGCATATTCGTGTGGNCTGGGAGNAGNTTCTAACCNCTATTGCCAGGACCA
  5   1   2       bld Tbd7                                 XL078f22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGACCATGTCAGACAGCTGGTCCCCCGTCGGGATCAGGCACTTACAGAGGAACACGCCCGACAGCAGCAGAATGAGCGACTGCGGAAACAGTTTGCTGCACAGGCCAATGTCATTGGACCATGGATACAAACAAAGATGCAGGAGATTGGACGCATTGCTATAGAAATGCATGGTACCCTGGAGGACCAACTGAATCATCTGCGGCAGTATGAGAAAAGCATTGTAAACTACAAACCAAAGATTGACCAGTTAGAAAGTGATCACCAACAGATTCAGGAAGCACTTATCTTTGACAACAAACACACCAACTACACCATGGAGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGT
  3   1   2       chi Tad2      in                    IMAGE:6873085.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTGAGTACATTATATGGAGGGCGGACTGGGGAGTCGGAGGGAAGGCGAGAGGCTACGAGGGGAGGAAATTGCCACCGGTGACCCCATCTAGGAAGTCTGGTCTGGGTTCTGCGCCCTCGTATAATGGCGGACATACCCCTGAAGGGCTAATCCTCAACGGAGTGGTAGCAGAGTCAAGCGGGGGCGGAGAGGGAATAAATCGGGCGAAGAGGGGAATAGGGGGAGGGTTATTTAGGGGGGTTATGTGTAAAGGGGCATCAAATAGGAGAGGGTAAATAAGGTCGGGTTCCCTCGCGCGTGGTGATCGGCGCATGAGAGCGATTTCCGCCATGTATCAACGTATAGGAATGTACGGGGATAATGTTGTCGAGATCACTTAGATAGCTTATCATTTCGGACAAGGGTTTGGCCCGGAAAAGAAGTTTAAAGACTTGCCCCATTCGTCGGGGGGTTACGATATGGGGTAACGATTCCCTCAGAATTAAAGCAGAATTTTACTCAAAGTATAAGCGTCGTTGACCCCAACAGACTGGGGGCTTGTGACATGTCAAGCCTTTATGGGATTAGTGTCCGGTGAGACGGCGGACACGGATACAGCTGACCAAGTCATGGCTTCATTCAAGATTCTGGCTGGCGATAAGAATTATATCACTTCGAATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCGTAAAGCGAGAGGGCGTGGGTAGGAGGAAGAAGAGGGGCCAGGGGAAGTGTGGGGTATAGTGGAAT
  5   1   2       bld Skin      in                    IMAGE:8641040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGAACAGTTTGCTGCACAGGCCAATGTCATTGGACCATGGATACAAACAAAGATGCAGGAGATTGGACGCATTGCTATAGAAATGCATGGTACCCTGGAGGACCAACTGAATCATCTGCGGCAGTATGAGAAAAGCATTGTAAACTACAAACCAAAGATTGACCAGTTAGAAAGTGATCACCAACAGATTCAGGAAGCACTTATCTTTGACAACAAACACACCAACTACACCATGGAGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCCTGATCAGCAGAATACTGCATTGNCCAGATGGGCTCATATATGGGACCTGACGCTGTTCCAGAGCTCTGGACTACATGTCTTCTCACAGCACTATATGAGAAGG
  3   1   2       chi DMZ  5g3  out                        xl286g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGAAGAAGAGTGGTTTCATGGAGAGTGATGATTTCCGAGCCTGTCTTATCTCCATGGGTTACAATATGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTAAAGCGAGAGTAC
  3   1   2       bld Skin      in                    IMAGE:8641040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACTACACCATGGAGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATGNCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTGTCCTAAAGCGAGAGTTACAAAAACCAAAACATTCAGGNNNNNNNGGGGCC
  5   1   2       bld Gas8      in                    IMAGE:3516747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTNGCCAGATGGCTCCATATATGGGACCTTGACCTGTTCCAGGAGCTCTGGACTACATGTCTNTCTCAACAGCACTT
  5   1   2       bld Tad2      in                    IMAGE:6873085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATATTCGTGTGGGCTGGGAGCAGCTTCTAACCACTATTGCCAGGACCATCAACGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCGTGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCATTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCCTTCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGGTTTCCGCCGTTCACGCCCTCTTGTGGTGTCATTTCCTTAGTTCACCAGGAAGATAAAAATCCACCTATCTCTCTTCTTTTGTGGTGCGCCTGGGGAGCCTCCTGGTCTGGGCAACTGCACAAGGGGTTAATTAACCTGGTTTCCAAAGTTTTGGTCCCTTTTAAAGGCGGAGGAGGTTCTTCCCAATTTCAGAAAT
  3   1   2       bld Ga18      in                      xlk149p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCATATTCGTNTGGNCTGGGANNAGCTTCTAACCACTATTGCCAGGNCCATCANCGAGGTAGAAANNCAGGTCCTCACACGAGANNNNAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTNNCTCATCAGCTTGGGTTACGATATTGGAAACGANCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTNCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGNCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATNTAAAATG
  5   1   2       bld Tbd7                                 XL082o10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCTGGGNNCAGCTTCTAACCACTATTGCCAGGNACCATCAACGAGGTAGNAAAATCAGGTCCTCACACGAGNATGCCAAAGGCATTACCCAAGNATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGNAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCC
  3   1   2       bld Skin      in                    IMAGE:8641763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAATAGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTAAAGCGAGAGTTACAAAAAAAACAANCCATTTCAACTTNNNNNNNTTCGCC
  5   1   2       bld Skin      in                    IMAGE:8641763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGGTAGAAAATCAGGTCCTCACACGAGATGCCAAAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGNCAGGGTTAATACCTGTTCAAGTTTGTCCTTAAGCGAGAGTTTACAATAAAACAAAAACATTTTACAGAGACTTTNNNaaaaaaaanaaaaaaaaaaaaanaaaaanaaaaaaaaNANAANNNNNNAAAAAGGGCGCGCAGGCTGATCCTAACGCGTCGGCTCTCC
  3   1   2       bld Tbd7                                 XL080b16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCATTACCCAAGATCAAATGAATGAATTCAGGAATTCTTTCAATCATTTTGATAGGGATCACTCTGGCAGGCTTGGCCCGGAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTGTCCTTAAAGCGAGAGTTACAAAAAAAACAAAAACAA
  3   1   2       bld Tbd2      out                   IMAGE:3199787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTTCCAATCATTCTGATAGGGATCACTCTGGCATGCTTGGCCCGAAAGAGTTTAAAGCTTGCCTCATCAGCTTGGGTTCGCATATCGCATACGATCCTCAGGGTAAAGCAGAATCAGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTAATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCAATGCAAGGGTTAATACCTGTTCAAAGTTAGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAG
  3   1   2       bld Neu7                                 XL019o08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTAAAGCGAGNAGTTTACAAATAAAAACAAAAACA
  3   1   2      seed Neu7                                 XL018k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTAAAGCTTGCCTCATCAGCTTGGGTTACGATATTGGAAACGATCCTCAGGGTGAAGCAGAATTTGCTCGAATTATGAGCATCGTTGACCCCAACAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCG
  3   1   2       bld Gas8      in                    IMAGE:3516747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGATTCTCAAGGGGAATGAGACTTTGCTCGTATTATGAGCATTAGTAGACCCAACAAGAATTAAGAGTGTTACATTCAAGCGATTTATGACTTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGCCAAAGTCATGGCTTCTTTCAATATTATTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGNTTAATACCTGTTCAAAGTTNTGTCCTTAAAGCGAGAGNTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCGATGATGTATTTTTCTGCCAACAAAACCCACGCGTCCGCCCACGCGTCCGGTTCTAGAGC
  5  -1   2       add Lu1                             IMAGE:4632902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAACAAGACTTGGGCTTGTTACATTTCAAGCCTTTATTGACTTCATGTCCCGTGAGACTGCAGACACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCTCCGGGAACTGCCTCCTGATCAAACAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCCGACGCTGTTCCAGGAGCTCTGAACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTATGAGCCCCCCAACAAATCACCAGAAGATaaaaaaaaaaaTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCAATGCAAGGATTAACACCTGTTCAAAGCTTGTCCTTAAAGCAAGAGTTTACaaaaaaaaaaaaCGGACGCGTGGGTCGACGA
  3   1   2       bld Ga18      in                      xlk134p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGGATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGGTTCACGCCTCTTGTGTGTCACTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCNNCNCTGCAAGGGTTAATACCTGTTCAAAGTTTNNCCTTAAAGCGAGAGNNACA
  5   1   2       add Ga18      in                      xlk134p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATACAGCTGACCAAGTCATGGCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGNNNNNNCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCNNNNNCTTGTGTGTCACTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGNTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACA
  5   1   2       bld Neu7      in                         XL049i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTCTTTNAAGNATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTacaaataaaaacaaaaacaatttttacagaaaaaaaaaa
  3   1   2       bld Neu7      in                         XL049i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTCTTTCAAGATTCTTGCTGGCGATAAGAATTATATCACTTCGGATGAACTGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTCTGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCCTTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTCTGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAA
  3   1   2       bld Neu4                            IMAGE:3475506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAATTATATCACTTCGGATGAAATGCGCCGGGAACTGCCTCCTGATCAAGCAGAATACTGCATTGCCAGGATGGCTCCATATATGGGACCTGACGCTGTTCCAGGAGCTATGGACTACATGTCTTTCTCAACAGCACTATATGGAGAAAGTGACCTTTAACCATTCCCTCCCCACTCAGATGTCACTACAGCAGTGCTTTCTCTATGTATCCCATGTGGTTTCAGCGTTCACGCCTCTTGTGTGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTA
  5   1   2       bld Lmb2      in                    IMAGE:8638068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAACTAAGAAAGAACCAAAAAATTCGAATTCGTCCCGTCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCGATGATGTATTTTTCTGCCAACaaaaaaaaaaaaTACCCCAAGGTGAAATGAATGCTTTGTGGTAAAGTTGTTCCGGCGCCTTGTTTATGTTGCGTATCCTTTGGTTACGGCATTATGGAGATCTTAACAGGTTTAGCATGAGTTACTCGCCTCACCTTATTTTCCTTTTAAAAAAACAAATGCatttttattttttttttatatatataaatatatttttGTGGCAAATTGGCAAGATAGAGCTGTGGTGTCCAACCTGTGAACCCCTCTACAGCTGCCGTTGAACTAAATGATCCAGCCAACGCCTGTGAGAGGAGGATGGTTACAGTACGGATATCCCAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGACATGGTTTAttttttttGTTTGGAAATATGAAGCTTAAATAATTTGTTCTCATATTGCTTTCACGGGCATATAAGAGTCTGTTTACGAGCAACAACCAAATAAAATAAAAAGCGCTGCAG
  3   1   2       bld Lmb2      in                    IMAGE:8638068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATTTCTTAGTTCACCAGAAGATAAAATCACTATCTCTCTTTTTGTGTGTGCTGGGAGCTCTGTCTGGCACTGCAAGGGTTAATACCTGTTCAAAGTTTGTCCTTAAAGCGAGAGTTTACAAATAAAAACAAAAACAATTTTTACAGAAGACATTTAAAATGCATATTTTATTATCGATGATGTATTTTTCTGCCAACAAAAAAAAAAAATACCCCAAGGTGAAATGAATGCTTTGTGGTAAAGTTGTTCCGGCGCCTTGTTTATGTTGCGTATCCTTTGGTTACGGCATTATGGAGATCTTAACAGGTTTAGCATGAGTTACTCGCCTCACCTTATTTTCCTTTTAAAAAAACAAATGCATTTTTATTTTTTTTTTATATATATAAATATATTTTTGTGGCAAATTGGCAAGATAGAGCTGTGGTGTCCAACCTGTGAACCCCTCTACAGCTGCCGTTGAACTAAATGATCCAGCCAACGCCTGTGAGAGGAGGATGGTTACAGTACGGATATCCCAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTATTTTTTTTGTTTGGAAATATCAACTTTAATATCGCCCGTGACAAGCAATATGCGAACAAATTATTCAG
  3   1   1       add Emb4 5g3  out                   IMAGE:4201881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGCGCCTTGTTTATGTTGCGTATCCTTTGGTTACGGCATTATGGAGATCTTAACAGGTTTAGCATGAGTTACTCGCCTCACCTTATTTTCCTTTTAAAAAAACAAACGCATTTTTTTTTTTTTTTATATATATAAATATATTTTTGTGGCAAATTGGTGATGTCCAACCTGTGAACCCCTCTACAGTTGCCGTTGAACTAAATGATCCAGCCAACGCCTGTGAGAGGAGGATGTTTACAGTACGGATATCCCAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTATTTTTTTTGTTTGGAAATATGAAGCTTAAATAATTTGTTCTCAATATTGCTTTTCACGGGCCATATTAAAGAAGTTCTTGTTTA
  3   1   1       add Ga18      in                      xlk140n23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTATTTTTTTTGTTTGGAAATATGAAGCTTAAATAATTTGNTCTCAATA
  5   1   1       add Ga18      in                      xlk140n23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTAGATCTTATGTGCGGCATTACACGGCTGCGAGTAAAACCTTCTTAGCTACTTGACCATATTTGTCAAATGAAAAGCAAACTCTTTGTTTTCAATATTTAATTTAAAGTACAAAAACTGTCACCAGCTCATAAAGTTATTTTTTAACGTTGCTGAACATGGTTTAttttttttGTTTGGAAATATGAAGCTTAAATAATTTGTTCTCAATATTGCTTTTCACGGGCCATATTAAAGAAGTTCTTGTTTaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)