Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4059119-IMAGp.5                16 END     12         92       75                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL009d23.3                            6 PI      78          3      256                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012771695 Xl3.1-XL097l10.3 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL097l10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATATCAGACATTTCAGGAAAGCTCGGCCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAA
                                                  Xl3.1-CHK-1012693402                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGACATTTCAGGAAAGCTCGGCCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAATACAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     3     4     3     4     5     5     5     5     5     5     5     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8    10    11    11    12    10    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    11    13    10    13    10    13    10    13     7    10     4     8
                                                                       ...PROTEIN --- Ce ---- 7e-009     NP_491533.2 UNCoordinated locomotion UNC-63, LEVamisole resistant LEV-7, nicotinicacetylcholine receptor alpha subunit (57.3 kD) (unc-63) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-009     NP_525079.2 CG2302-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-009     XP_001192374.1 PREDICTED: similar to nicotinic acetylcholine receptor alpha2 subunit [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-009     XP_311925.3 AGAP002971-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-010     XP_617408.4 PREDICTED: similar to Neuronal acetylcholine receptor subunit alpha-4 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 3e-033     XP_001476491.1 PREDICTED: similar to acetylcholine receptor alpha-subunit [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-033     NP_001034612.1 nicotinic cholinergic receptor alpha 1 isoform a precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-034     NP_990147.1 alpha-1 subunit, nicotinic acetylcholine receptor [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cf ---- 3e-034     NP_001003144.1 nicotinic acetylcholine recepter alpha-subunit [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 9e-035     NP_788837.1 cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 9e-035     NP_571520.1 cholinergic receptor, nicotinic, alpha polypeptide 1; nicotinic acetylcholinereceptor alpha-1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 3e-044     NP_989361.1 hypothetical protein MGC76192 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-044     NP_001085869.1 MGC80957 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL097l10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------ATG------------------------------ATG---------------------------------------------------ATG---ATG------TGA------------------ATG---------------------------------------------------------------------------------TAG------------------ATG------------------------------------------TAATAATGA---------------------------------------TAG------------------------------------------------------------TAG------------------------------------------------------------------------------------------------ATG------------------------------------------TAA---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                     ]
  3   1   2       bld Ga18 5g3  out                      xlk73m01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTTCTGGTCNTCGTCGAATTGANCCNTCAACGTCAAGTGCTNTNCCTTTAATNGGAAATATATGTTATTCCNCCATGGTCTTTGTNATCGCTNCTATTATTNTNACAGTCATTGTCATCAANNCCCATCNCCNCTCCCNAAGNNCTCACACTATGCCTCCGTGGGTGAGAAAGATTTTTATAGAACCNTCCCAAACATCATGTTCTTCTCTACCATGAAACGTCCTTCACACGAAAAACAGCCCCAGAAAACATTTGCAGAAGAGATGGACATATCAGACATTTCAGGAAANCTCGNNCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATNCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGCGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANNGAAATAATAGC
  3   1   2       bld Emb4 5g3  out                   IMAGE:5536412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAAACATTTGCAGAAGAGATGGACATATCAGACATTCAGGAAAGCTCGGCCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTAAAAAATTCTAAAATAACACAGCATCAGGAANAANNGCTCCNTATCTTAGG
  3   1   2      seed Tbd7      out                        XL097l10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACATATCAGACATTTCAGGAAAGCTCGGCCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAATACAATA
  3   1   2       bld Neu7      out                        XL023l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATATCAGACATTTCAGGAAAGCTCGGCCCAGCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGCGCTTTTTTACTTTAATATTCTAAAAAACACAGCATTA
  3   1   2       bld Tbd7      out                        XL107o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGCAGTGACTTATCAGTCCCCGGCTCTAAAGAATCCTGATGTAAAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAAAAAGCTACAATAAATACAATA
  3   1   2       bld Tbd7      out                        XL069j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTAACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGNTACAANAAATACAATAT
  3   1   2       bld Neu7      out                        XL017d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAATACAATA
  3   1   2       bld Tbd7      out                        XL055a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGTGCCATAGAGGGCATTAAATACATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCGGAGGAATGGAAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAANACAATA
  3   1   2       bld Tbd7      out                        XL082p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAANATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAAAGCTACAATAAATACAATATNAAGG
  3   1   2       bld Tbd7      out                        XL087m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTA
  3   1   2       bld Neu7      out                        XL001m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTTTTCATGACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTGCTGGGCGTATCATTGAAAATGAATATGCAGGAATGAACAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTACCATACAACATACAATGTGCTTTTTTACTTTAATATTACTAAAATAACACAGTCATTAGGNAAATAATAGCT
  3   1   2       bld Tbd7      out                        XL088m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGTGTTGNATCATATCCTNCTNNCTGTTTTCATAACAGTCTGTGTCATAGGAACTTTAGCTGTGTTTNCTGGGCGTATCATTGNAATGAATATGCAGGAATNGTCAATTTTTGTATTTCTAATGCCAAACAAGAAAGGAATAGTTTTAGCTCCACCATTGCCTATAGTTTTCCTACATCTCAAGAATAGCAAACATGTAACCCTCTAGGTTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTNACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTANGAAATAATAGCTACAATAAATACAATA
  3   1   2       bld Tbd7                                 XL062n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTACCAGCCCAAGCTCATGACACACTGTCCCATACTGTCTGAGAAACATATAATATTGTTATAATAATGACCCTGTTGTGCTGCTCCAAGATTATGCAGAGCAGCAAATTAGCATTTACCCCAAATCTTAACCTGCTCACTGCTCAAACTGGTTAACAGTTTCATACTGCTGTAGGTATTGGTGAGTTTGCAAGTTGTGGGCATTTTAGTTCAGCAACAGCTATCGGGCCACAGGCTGGACATTCATTATCTAGGTGCATGCAGTTCAACTATGGAGATTAATGTTCCATACAACATCAATGTGCTTTTTTTACTTTAATATTCTAAAATAACACAGCATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)