Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:3377728-IMAGp.5                24 END     1           7        4                (no blast hit)
     2   2.0    0Xl3.1-XL492d21ex.3                          8 END     6          42       75                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL040h22.5                            5 PI      92         16      647                hypothetical protein LOC779149 [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012771712 Xl3.1-PBX0097F11.5 - 14 ESTs
                                                                       ..-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0097F11.5                                                                                                                                                                   TATCCCCTGCTGCTGCTGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCCCACTCCAC
                                                  Xl3.1-CHK-1012692548                                                                                                                                                                         CTGCTGCTGCTGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCCCACTCCACCGGTGG
                                                      consensus depths                                                                                                                                                                        3     6     8     9     9    11    10    11    10    12    10    12    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    12    14    13    14    13    14    13    14    11    13    12    13    11    12    11    12    10    11     8     9     9     9     9     9     9     9     9     9     7     8     7     8     6     7     6     7     6     7     5     6     3     4
                                               BLH ATG     108     418                                                                                                                                                                   
                                               BLH MIN     108      69                                                                                                                                                                   
                                               BLH OVR     108      98                                                                                                                                                                   
                                               EST CLI      -9      45                                                                                                                                                                   
                                               ORF LNG     108       2                                                                                                                                                                   
  5   1   2       bld Tbd7 5g3  out                        XL051b12.5p GCTACACTAGCAGCCCCGAGCTTGTCTCCTGTCTCCACTACAGAAACAAATCGCAACTCCTCCTCCATCGTCACCTCCCCCTCTCCCCGGCTGCTGGGAAGGTTTAGCAGTGGCAGGTCAGCCCCGGATTCCTTCTGTTCCCTGCGCTGGACTCAGACCTCCTATCCCctgctgctgctgctgctCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTCCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAACGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAG
  5   1   2       chi Neu7      in                         XL012b16.5p                                                                                                       GTTCTACAAAGNAAGAAGTCTGCTGGAGCAGCACTATTAACTGATGCCTTTTGAAAAAAAGATGTTTTCTGATGACATGATTAGCAAATTGCACTCACACACCCTGGCCTTGGATAGAAGATAGTCCCTGGTGCACAGCAATGGTAGAATCGGCGTCCCACCTTGAAATGACGAATCAAAAGGAAATTCACTGGCACACAGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCCTCGGTTCAGGA
  5   1   2      seed Egg1 5x3                           PBX0097F11.5p                                                                                                                                                          CAGACCTCCTATCCCctgctgctgctgctgctCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCCCACTCCACCGGTGGACT
  5   1   2       bld Emb4 5g                         IMAGE:4680668.5p                                                                                                                                                          CAGAcctcctatcccctgctgctgctgctgctcctgacacctccttctccctcccgggctccAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAAGAGAGTCGTCAATAGCT
  5   1   2       bld Neu7 5g3  out                        XL015c20.5p                                                                                                                                                             GCTCAGACCTCCCATCCCCTGCTGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGC
  5   1   2       bld Ga12 5x3                             XL143m04.5p                                                                                                                                                             GCTCAGACCTCCCATCCCCTGCTGCTGCTCCTGACACCTTCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCC
  5   1   2       bld Em10 5g3  out                   IMAGE:7982971.5p                                                                                                                                                                      ctgctgctgctgctgctgctCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCTCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCCCACTCCACCGGTGGACTATTTGCAAACACGCAGG
  5   1   2       bld Neu7 5g3  out                        XL044a15.5p                                                                                                                                                                             CCCTGCTGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCA
  5   1   2       bld Neu7 5g3  out                        XL021b18.5p                                                                                                                                                                             CCCTGCTGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCC
  5   1   2       bld Emb4 5g                         IMAGE:4679891.5p                                                                                                                                                                                  TGGCTGCTCCTGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGGTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGC
  5   1   2       bld DMZ  5x3  out                        xl292o06.5p                                                                                                                                                                                       GCTGCCGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCCGCAATACCTTATTTCCCATTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAATACAATTAAAATCAATGGTGACCTACAACTGACCAAACTTGGTTGACGATTGACTATGTTCCCACCCCAGCGGTGGACGAGTACAAGCAACGCAAGGTCACAAGCAGCGCAGTTCATTGTGTCC
  5   1   2       bld Tbd7 5g3  out                        XL081d23.5p                                                                                                                                                                                                           CTCCCGGGCTCCAGAATGATCCGGTGCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTNATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCA
  5   1   2       bld Emb4 5g                IMAGE:4679891-IMAGp.IMAGp                                                                                                                                                                                                                                    GCCCCTGCTGCCTTTGCTTATCCGAGCGAGGCTTCTGTGCAAGATGGCGGGATCTTTGGTTGAAAGCGAAGCACTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTAACGTCACCTGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTACGGAATGCACGTGTATCCGGACAGTGGGGAGAAGAAGAGTCGTCAATAGCCTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCC
  3   1   2       bld Neu7      in                         XL012b16.3p                                                                                                                                                                                                                                                                                                                                                         TGTACAGGCTGAGGTTTATTTTCCACGGCTGACAGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCGGGAAAGAAAATCCTTATCATGGGAATTGTTAACCTGGAGCCAAAGAATTTTGACATCAGGTTGACATGTGGGGATTCAGAAGATCCAGCAGCCGATATTGCCATTGAGCTGAGGGCAGAGTTTTCTGACAAACAGTTTTTAAGGAATGCACGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCGTCAATAGCTTATTTCCCCTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCGGTTCAGGATATTTGTGGATGGACATCAGCTGTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAACACGATTAAAATCAACGGCGACCTACAACTTACCAAACTTGGTTGACGACTGCCGATGTTCCCACTCCACCGGTGGACTAGTTGCAAACACGCAAGGTTGCCAAGCAGCGCAGTTCATTGTGCCAGAAACACCAGGCCCAGGGACAATAGTTACAGAGAGCCAGTTTTGTTTCATTGTTTTAATGGACCGTGCGGTACTTATACAGGGGCTGCCATGTATATTACCTACACTTAACCTTTTTTTGGCCGGACTACAATAAACGGAAACAGCAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)