Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8820711.3                       3 END     3           9      100                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5505831.5                       3 END     1           3       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7973775.3.5                    90 PI      77       1217     1657                XB-cadherin [Xenopus laevis]
     4   0.0    0Xl3.1-XL005g13.5                            8 PI      77       1214     1657                C-cadherin [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012771751 Xl3.1-xlk146n09ex.3 - 31 ESTs
                                                                       ...-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk146n09ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCGTTCTTACAACTGGATTAGACAGAGAGAAAAACCCAGTGTACACACTGACAATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCTACAGCTTTAATCGTTGTGATGGACACTAACGATAATCCTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTCTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCAGCTTCACCGTGGCCTCGATGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTGTAATAAAATAAAGATGT
                                                  Xl3.1-CHK-1012687984                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTACAACTGGATTAGACAGAGAGAAAAACCCAGTGTACACACTGACAATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCTACAGCTTTAATCGTTGTGATGGACACTAACGATAATCCTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTCTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCAGCTTCACCGTGGCCTCGATGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTGTAATAAAATAAAGATGTACCTAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     5     6     8     8     8     9     8     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7     8     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     5     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     6     9     6     9     6     9     6     9     6     7     5     9     5     9     5     9     4     9     4     8     4     8     4     8     4    10     4    11     5    11     4    10     6     9     5    10     6    10     6    10     6    10     7    10     7    12     7    12     7    12     7    12     7    12     7    12    10    14    12    15    13    16    13    16    13    15    13    15    13    15    13    15    13    16    13    16    13    16    13    16    13    16    14    16    13    16    15    17    15    17    15    17    15    17    15    16    15    16    16    16    16    16    16    16    15    16    17    17    14    17    15    17    15    16    15    15    14    14    14    14    14    14    14    14    14    15    14    15    14    15    14    15    13    14    13    14    12    13    12    13    13    14     8    14     7    14     7    14     7    14     7    14     7    14     7    14     7    13     8    13     7    13     7    13     7    13     7    13     5    11     4    10     2     9     2     8
  5   1   0       add DMZ       in                         xl333h06.5p TCGATTCGGCCTAATCATCGAATAAGTGAAGTGTTATGGAGCAGTGAAAAGATACTCAAGAACTGACTTTTTCCCCTTCATGTCATGATGAGCTATTTACAAAATAGAAGTATTTTTAAGTACTGAAACCTTGCTTTCTAGAGTTGATGCAAGCATCTCAGAAATGCGAGGAGGCATGCTTTATCTATAAATACAGTTTGTAACTAACCATTGAAGTGACTGAGAAGAGTTTTAAAAAACATGAATTTTATTTTTAGATTAAATCCAGCTATGCAAAAGAAGTCAAGGTTTATTACAGTATCACAGGACAGGGTGCGGATACACCTCCAGAAGGAGTGTTCGCTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGACAATTACGTTCTTTTTTCCCATGCTGTGTCATCAAATGGGGCAAATGTGGAAGATCCCATGGAAATCATAATTAAAGTACAAGATCAGAATGATAATGACCCAGTATTCACACAGTCGGTCTTTGAAGGCTCTGTGCCTGAAGGGTCTAAGCCAGGTACGGCTGTTATGACTGTATCTGCAACAGATGCCGATGATAGTGTGGACATGTACAATGGTGTGATTACCTATTCTATTCTCAACCAAGAGCCCAAAGAGCCCACCAATAAAATGTTCACTATCCATTCAGAATCTGGGCTGATCAGCGTTCTTACNACTGGATTAGAC
  5   1   2       bld Ga15                               XL414h08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGTACAATGGTGTGATTACCTATTCTATTCTCAACCAAGAGCCCAAAGAGCCCACCAATAAAATGTTCACTATCCATTCAGAATCTGGGCTGATCAGCGTTCTTACAACTGGATTAGACAGAGAGAAAAACCCAGTGTACACACTGACAATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCTACAGCTTTAATCGTTGTGATGGACACTAACGATAATCCTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTCTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCNCT
  5   1   2       bld Ga15      in                       XL423d20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGCGTTCTTACAACTGGATTAGACAGAGAGAAAAACCCAGTGTACACACTGACAATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCTACAGCTTTAATCGTTGTGATGGACACTAACGATAATCCTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTCTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGGCTGCTGACAGTGGGCTCTCCTTCA
  5   1   2       bld Ga18      in                      xlk146n09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTAGACAGAGAGAAAAACCCAGTGTACACACTGACAATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCTACAGCTTTAATCGTTGTGATGGACACTAACGATAATCCTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGNTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAANGANCCAGCAGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAANGGCAATTTGGNTCGGGAATCAAAATTTGTNCTAAACAACACCTACAAAGNCATAATCCTGGCTGCTGACAGTGGNTCTNCTTCAGCCACTGGGNCT
  5   1   2       bld Emb9                            IMAGE:7977917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCAGTGTTTGACCCCACACAATACACGGCAAAGGTTCCTGAAAATGAAGTTGGCTATGAGGTCGCACGTCTTACAGTAACAGATGAAGATATTGAGGGTACAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTAACTATTTCAGTATCCAAACAGACACTGGCAACATTGGGCTTTTGAAAACAGTGAAGGGTTTGGACTATGAGCTGAAGAAGCAGTATATTCTCTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTGCAAACTTCAACTGCAACGGTGACTGTATCTGTCGAAGATGTAAACGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTTAATCTCCTTTGATGTTATGATAAACGGACCATTTTTGGAGCCCCAACAAGAAAAGTTTTCTGCCAGAAAGATCCCAGGCTTTTCGTGTA
  5   1   2       bld Int2                            IMAGE:8821002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCACCCGAATACCATAGGAGCCCACCACATACAAAATTCGTCCCGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCTTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTATCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAGAGCCTTTACTACCTCCAGAGATGAGACTCGGACAATGTGTTTTCTATGATGAGAGGTGGTGTGAGAGACAGGATTTGATTTAAGCAGCTCACGTGACCCTCGATGCCTCCGTCAGAAAGTATATTCGCGGTAAAT
  5   1   2       bld Ga15      in                       XL445k04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAAGCCCCAATATTTTTACCACCAGTGAAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTATCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCANCCATAGTTGGAATCCTTGGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACNAA
  5   1   2       bld Em10                            IMAGE:8321404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAACTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTTGGAATCCTTTGGCGGGATCCTGGCACTTCTTTAATTGCTGTTGTTGCTCTTACTTATTTG
  5   1   2       bld Int2                            IMAGE:8529520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTTTCTGTGTCAGAGGATCTTCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAACTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGNACTCGGGACATGTGTTTTCTATG
  5   1   2       bld Int2                            IMAGE:8528913.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNAGATCCATCGATACGAATTCGTCCCGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAGATAACTTACGTCATTGGAAATGACCCAGCAGGGTGGGTGTCGGTAAACAAAGATAATGGGATTGTCACTGGAAATGGCAATTTGGATCGGGAATCAAAATTTGTGCTAAACAACACCTACAAAGTCATAATCCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAGTGGTAAAAGAGCTTTACTACCTCAGAAGATGGACTCGGGACATGTGTTTTCTATGATGAGAANGTNNGTGCGAGAGAACAGATTTGATTAGCAGCTCACGTGCTCGAGCTCTCAGAGTATCGTAGA
  5   1   2       bld Tad1      in                    IMAGE:6879492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTGGCTGCTGACAGTGGCTCTCCTTCAGCCACTGGGACTGGAACCCTTGTGCTTAATCTCCTTGATGTTAATGATAACGGACCATTTTTGGAGCCCCAACAAGAAAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTACTATCATTGACAGAGATCTCTCCCCTAACACATACCCGTATAAAGCAGAGCTGACTGGTGAATCTAATGAAAACTGGACTGCTATAGTGACAGGACAAAGTATACTTGAGCTCAGACCTAAAAAGAGCTGGAGATTGGACAATACGATGTGATGATCACACTGTTAGACAGTTTTGGACTATCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGACCCTTTACTACCTCCAGAAAATGAGACTCGGGACAATGGGTTTTCTTATGATGAAAAAAAGTGGTGGGTGAAGGAAGACCCAGGATTTTGAATTTAACCCAGCTTTCCCCTTGGCCCTCGATGCCTCGTCCAAGAAGTAATCCCGTAATGGACGTTTCCTCCCCTTTTTAAACCTGCTCCCCCCAGTAATCGAACCCCCGTCCTTGGCCCATTCCCAGATagaaaatttggaaaaatttttatagaatggaaaaacccttggaatggccaccctggaaaaatgggaaccccccccctgggcctccccccccAAATAAAGA
  5   1   2       bld Emb4      out                   IMAGE:4970072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTCGATCCACGCGTCCGCAGACCTAAAAAGCCCTCTTATAGATTGGACAATACGATGTGATGATCACACTGTTAGCCCTTTTTGGACTGTCAAATGTGACAAAGCTCCATATTACTATCTGTCAGTGTGATGGTGACAAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCATCTTTTTCGTGGCCTCGATGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTNGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAGTGCACAATGCTAACCGTAACTAAAACCATAGCTGTGTATGCAGACTTGGAATTGCTTGTTTCTCTGTCTCGAA
  5   1   2       bld Brn3                            IMAGE:8536492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACAGATGCAATGTGAGGAAAAGGCTGCTATAGCAGGAGGCTTGGGCATATCAGCCATAGTTGGAATCCTTGGCGGGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTCTTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCAGCTTCACCGTGGCCTCGATCCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCATTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTTACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACAGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATCGTTTAGAAATATTTTATGGCTATGTATATAAGaaaaaaaatcgtattttttgtactttttgtgttttAATA
  5   1   2       bld Tbd7      out                        XL096b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATCCTGGCACTTCTTTTATTGCTGTTGTTGCTATTACTATTTGTACGAAGAAAGAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCAGCTTCACCGTGGCCTCGATGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaaTCGTATTTTTTG
  5   1   2      seed Tbd2                   IMAGE:3200317-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAGTGGTAAAAGAGCCTTTACTACCTCCAGAAGATGAGACTCGGGACAATGTGTTTTCCTATGATGAAGAAGGTGGTGGTGAGGAGGACCAGGATTTTGATTTAAGCCAGCTTCACCGTGGCCTCGATGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACT
  3   1   2       bld Tad1      in                    IMAGE:6879492.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGCGGGGGCGCATTACGGAAGGGCTATGGGTCCCCAAGAGTTGGTAACTTCCCCGCTAAAAATGGACAGTTGTGTCTCGCCGCGTTTTTTTAGGGGGGTATTCCCCCCCAGTTTATGGCGAATCCCTCTATCCCGTTATCAATTACCAAGAGTGGTAAAATTGGGGAAGTTTTTTTATAGGTATGAGAAATTGTGAAATTCAAGGTTGGCCAAATGGACCCCAAATTGGTTTCCTCCCATTAGGATCTCAGCTTCCTTGGGTTTTAGATTTCGGAAAGGGCAGTTGGGTTCTGTGGGCCGCAATCCACTCAAGCTTCTTCAGAGACTCGTACCAAGTTAGAATTTAGATTCAAGGATTATGAGTGGCTTTTGAAAAGAACGGGGGGACTTGCGTTTCCACCAAATTTGGCAGACATGTATGGAGGTGATGAGGGATTAAAAAGTGCACAATGCTAACGGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCACCTTTTCGGGAAAGGGNGTTTCCCCGCCGCGGAGACAAGTCTGGGGAAGTTTAGCGGAGCGGACGGTCGAA
  3   1   2       bld Ga18      in                      xlk146n09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNNGACNAGGNTTTTGATTTAANCCAGCTTCACCGTGGCCTCGATGCTCGNCCAGATGTAATCCGTAATGNCGTNGCTCCCGTTTTAGCTGCTCCCCAGTATCGNCCCCGNCCTGCCAATCCAGATGAAATTGGAANTTTNATAGATGAGAACTTGAATGCAGCTGACAATGNCCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTANNCTTNTNTAATAA
  5   1   2       bld Skin      in                    IMAGE:8640472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTTaaaaaaaatacaaaaaaaaataaaaaaaTTCGTCCCTGCTCGTCCAGATGTAATCCGTAATGACGTTGCTCCCGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCCATaaaaaaaaaTAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATATATACATATGATCACACACACAGAGCTTGCTTGTTCAACGGAATAAATTATATTATAACTTGGGTTTaaaaaaaaTCAGCTTATGAGCTAAATGGGGCCAGACTTTTGATATCCTCTGCATTGTATTGGACTTGCCATGTTACTTTTGTATAAACTAAAGATGTTACCTTAATTATACTACCAATACTATATTATAGT
  3   1   2       bld Emb9                            IMAGE:7976266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATACGCCAGGATTCTCCAGAGACCTTCGATGCTAGTCAAGATGTATGCAGTAATGACGTGCTACCGCTTCAGCTGCTCCCCTAGTATCGACCCGGTCCTGCCATTCCAGATGAAATTGGCACATTTTTTAGATGAGAACTGAATGCAGCTGACAGTGACCCCACTGCTCTCCCATACGACTCACTCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTGTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATACGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGAGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGATATACTGTAGGGATATGTTTTGCCAGCAAAAGAAATCCCAAAACCG
  5   1   2       bld Int2      out                   IMAGE:8820711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACTGTGATCGCATGGACTAAAGGAACTTAATTATTCGTCCCCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTTATAGATGAGAACTTGAATGCAGCTGACAATGACCCCACTGCTCCCCCATACGACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAAGAAATTCCATaaaaaaaaTAGAAATGAATTTGGCGACGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGATAAATATATTATAACTGGGTTaaaaaaaaTCAGCATATGAGCTAAATGGGCAGATTTTGATATCTTCTGCATTGTATTGACTGCATGTATACTTTTGTATAAATAGATGTACTATATACACATTTTTATTGCTAGTGTTTCATGTAGCTTTATAATACCAATTATGTCTTCGCAGTCGTAATGGCTTATTATATGGTTCCATTCTTATCTATAGC
  5   1   2       chi Emb4                            IMAGE:5536575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTAAAACGGGAGCAACGTCATTACGGATTACATCTGGACGAGCATCGAGGCCACGGTGAAGCTGCTCCCCAGTATCAATCACTCCTTGTGTTCGATTACAAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATaaaaaaaaaaaaaaaGG
  3   1   2       bld Skin      in                    IMAGE:8640472.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATGAAAATAGAAATTTTTATGTGAGAACTGAATTGCAAGCTGACCATGACCCCACTGCTCCCCCATACGACTCACTCCATAGTGTTCGATTTACGAAAGGCAGTGGCTCCGAGGCCGCAATCACTCAGCTCTCTGAACTCGTCCAACTATGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCA
  3   1   2       bld DMZ       in                         xl333h06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGAGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACCTTGGCAT
  5   1   2       bld Tbd7      out                        XL058k04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACTCCTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATaaaaaaaaTAGAAATGAATTTGGCGACGGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAA
  5   1   2       bld Tbd2                            IMAGE:3200317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGTGTTCGATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGGAATGCTCAAGAGTGACTCCTCCTACTTTTGTGAAATTGGTCAGAGATATTTTATGGATATGTATGTATGAAGAAAAATCGTATTTTTTGGACTTGTTGTGT
  5   1   2       bld Skin                            IMAGE:8644672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTACGAAGGCAGTGGCTCCGAGGCCGCATCACTCAGCTCTCTGAACTCGTCCAACTCTGATTTAGATCAAGATTATAGTGCTTTGAATGACTGGGGACCTCGTTTCACCAAACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATaaaaaaaaTAGAAATGAATTTGGCGAGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTaaaaaaaaTCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTTTGTATANNATAAGATGTACCTAATATACCNACaaaa
  3   1   2       bld Ga15      in                       XL445k04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATAGTGCTTGGAATGACTGGGGACCTCGTTTCACCANACTGGCAGACATGTATGGAGGTGATGAGGATTAAAAAGTGCACAATGCTAACCGTAAACTAAAANCCATAGCTGTGTATGCAGACTTTGGAATTNGCTTTGNTTTCTCCTGTTCTCAGAACAGAGGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGAAAAAAAATCGTATTTTTTGTACTTTTTGTGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTAAAAAAAATCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTT
  5   1   2       bld Ga15                               XL517m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTAAACTAAAAACCATAGCTGTGTATGCAGACTTTGGAATTTGCTTTGTTTTCTCCTGTTCTCAGAACAGAGCTACGAAATGCTCAAGAGTTACTCCTCCTACTTTTGTGAAATTGTTCAGAAATATTTTATGGATATGTATATATGaaaaaaaatcgtattttttgtactttttgtgttttAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATaaaaaaaaTAGAAATGAATTTGGCGAGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTaaaaaaaaTCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTGTAATAAAATAAAGATGTACCTAAATATACNACaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL423d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGTTCAGAAATATTTTATGGATANGTATATATGAAAAAAAATNGTATTNTTTGTACTTTTTGNGTTTTAATATCCCTGCAGTTTATAATACAAGAGGATCTTTATCTGCTTATATCTAAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAANGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATAAAAAAAATAGAAATGAATTTGGCGAGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAAGCTGGGTTAAAAAAAATCAGCATATGAGCTAAANGGGGCAGAATTTTGATATCTCTGCATT
  5   1   2       bld Skin                            IMAGE:8642237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGCTTATATCTAATATAAAAAGCCTGCTGGGATTCAGTATGATTTTAATGGGTTGATACTTTGATACTTGACCCTTGGAAGGAAATTCCATaaaaaaaaTAGAAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCATTTTTTCCATAATATACATATGATCACACACACAGAGCTTGCTGGTCAAACGGAATAAATATATTATAACTGGGTTaaaaaaaaTCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTGTAATAAAATAAAGATGTACCTAAATATACAACAAATATATATTGCTAGTTGTTTTCACTGTAGCTTTATATACAGATTTATTGTCCTTTCCGCCAGTTCTGTAATGGCTTATTTATATGTTCTCATTCTATCTATAGCGGTAACCCACAATTACCAATCAGCAACTAGCTTTTATTCTACTACTACAAGCTGTAAACATTAAATCTAAACAGGGGTTTAGTTGGTTGCTGTGGATTATGCTCTAGTGCAATCACATATAATAGGTATAAGTCCTCTAGACATTAAATTCCATGATAGATATGGGCAAACCATTGTTTAATACTGTGTTAAAGTGTGTANGTTTGGGAAAATATTAACCCCATGTTTGAACGTACCATTTGTATGCTTCTTTGAAAAAACATTTTCTATTTCGCCAAAAAAACTACAGAAACCTACTGCGTAGCTATACCCATTGATCTTGAAAAGCCCAATGTGAAAAT
  5   1   2       bld Ga15                               XL461c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGAATTTGGCGACGGGGGGAGTTGCCATGGTCTGATTTGCNTTTTTTCCATAATATACNTATGATCNCACACNCAGAGCTTGCTGGTCCAACGGAATAAATATATTATAACTGGGTTaaaaaaaaTCAGCATATGAGCTAAATGGGGCAGAATTTTGATATCTCTGCATTTGTATTTGACTTGGCATGTATACTTTTGTAATAAAATAAAGATGTACCTAANAANAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)