Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl221g10.3.5                         19 END     3          12       15                hypothetical LOC496558 [Xenopus tropicalis]
     2   2.0    0Xl3.1-XL051j05.3                            6 END     4          16       66                hypothetical LOC496558 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl221g10.3.5                         19 PI      92        815     1497                hypothetical LOC496558 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012771777 Xl3.1-IMAGE:6868874.5 - 24 ESTs
                                                                       .......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6868874.5                                                                                                  GCGGCGCCCTTTGTCCGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGAGGAGAGTTTGGCTGTGATGGAGACTCGCCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGTGAGGAGGAGGTGGGAGGAGAATCAGAGGAAGATCCTGGGGGAGAGAACAGGGAGGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAAGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGACGCCCGCTACCGCTGCAGCGACTGCAACAAACACTTCACCACCGCCGGCAACCTGAAGAGGCACCAGCTGGTCCACAGCGGAGAGAAACCGTATCACTGCGAGTTCTGCAACCGCCCCTTCTCTGACCCCACCTCCAAAATGCGCCACTTGGAAACGCACGACACCAACAAGGAGCACAAGTGCCCCCACTGCGACAAGAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAACG
                                                  Xl3.1-CHK-1012688965                                                                                                        CCCTTTGTCCGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGAGGAGAGTTTGGCTGTGATGGAGACTCGCCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGTGAGGAGGAGGTGGGAGGAGAATCAGAGGAAGATCCTGGGGGAGAGAACAGGGAGGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAAGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGATGCCCGCTACCGCTGCAGCGACTGCAACAAACACTTCACCACCGCCGGCAACCTGAAGAGGCACCAGCTGGTCCACAGCGGAGAGAAACCGTATCACTGCGAGTTCTGCAACCGCCCCTTCTCTGACCCCACCTCCAAAATGCGCCACTTGGAAACGCACGACACCAACAAGGAGCACAAATGCCCCCACTGCGACAAGAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAACGGACGGA
                                                      consensus depths                                                                                                       2     5     3     5     4     7     7    10    11    14    14    16    16    17    16    17    16    17    17    17    17    17    17    17    17    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    16    17    16    17    16    17    15    17    15    17    14    16    14    16    14    16    14    16    14    16    14    16    14    16    15    17    15    17    12    14    11    13    12    14    10    14    10    14    10    14     8    12     7    11     7    10     6    10     6    10     6    10     6    10     4    10     4    10     4    10     4    10     4    10     4    10     3    10     3    10     3    10     2    10     3     9     3     8     3     9     3     9     3     9     3     9     3     9     4    10     5    11     5    11     5    11     5    11     5    10     5    10     5    10     5     9     5     9     5     9     5     8     5     7     5     6     5     6     5     5     5     5     5     5     5     5     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     2     2
                                                                   SNP                                                                                                                                                              --G---T-----
                                                                   SNP                                                                                                                                                                                                                                                                          ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                  -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --G---------
                                               BLH ATG      72     899                                                                                                  
                                               BLH MIN      63     147                                                                                                  
                                               BLH MPR      63     147                                                                                                  
                                               BLH OVR      63      94                                                                                                  
                                               CDS MIN      63       6                                                                                                  
                                               EST CLI      25       6                                                                                                  
                                               ORF LNG      63      23                                                                                                  
                                                                                                                                                                                                                                       PREDICTED = Gg ==== 8e-054     XP_001234798.1 PREDICTED: similar to zinc finger and BTB domain containing 17 [Gallus gallus] ===============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PREDICTED = Dr ==== 4e-145     XP_693378.3 PREDICTED: similar to zinc-finger protein [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PREDICTED = Cf ==== 1e-151     XP_848760.1 PREDICTED: similar to Zinc finger and BTB domain containing protein 17 (Zinc finger protein 151) (Myc-interacting zinc finger protein) (Miz-1 protein) [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PROTEIN === Hs ==== 1e-155     NP_003434.2 zinc finger and BTB domain containing 17 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PREDICTED = Bt ==== 2e-156     XP_590523.3 PREDICTED: similar to zinc finger and BTB domain containing 17 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PROTEIN === Mm ==== 8e-157     NP_033567.2 zinc finger and BTB domain containing 17 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PREDICTED = Xt ==== 0          NP_001011141.1 hypothetical LOC496558 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PREDICTED = Xl ==== 0          NP_001089997.1 hypothetical protein LOC735068 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6868874.5                                                                                                                       TAG---------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       chi Tbd3                            IMAGE:3550271.5p GCTGAGCTGGNAAAGCAACTGGAGGGCGGGGAGTGCGAGGGGACAATGCAACGGGCGCGGCTGCCGGATAGGGGATCCCAGGGAACGTGTTTCCTTCTTCCGGTCCTGCTGGGCTGCGGCCAGTTTCCCGGTGTAGGTGGGACTGACCCACTGAGCCGACGCCTCGTCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGT
  5   1   2       bld Oo1                             IMAGE:5085009.5p                                                              ACGTGCAAGCGCTGTACTTCCGCCCCGACTGAAGATGGCGGCGCCCTTTGTCAGACCGTAGGTGTGAGCTCTGTTATGTGAGATCAGAGCCGGTCCGGGATCTCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCAACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCACTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGGCGCAGGGAGAGGGAGCAGTTCCAGGCTCTGCAGAGAATGATGGGAACAGAGTGGGAGAATGTGATGAGGCTGCAGTAATATACCCGCATGGTCGGCACAGGTGAGGGAAACTTGTGTTAGAGGACCCCCCCAGATGTGGGATAAAGAAAAGGAAGTTTGGGAATGGAGAAGCCGCGTGGCCCCAGCAAACGCCATTCAGGCGCTGGGGAACCGTCCCCTTGGCTTGGGGGGAGGAAAAGGGAAAACAAGGGGACCTGGGCCCCGCAGGCAAAATAATTCGGTCCCCGGGCCCAACGCGCAACCGGGCTTGGAAGGAGTTTCAAACACAGGGTGGGGAGAGGGGGAACTCCCCTCGGGGCGGCAAGCGAGTTATATCTTCCCACCCACACCCGTGCGCGGTAGGCCCCAGCGCACCTCCCCCGATCATCCGCCACTGCTAAGGGTTCCCACCACCCCGGGAAGTCTAACGcccctccccccccGCTCCGCCCGGGGCTAGATGTTCCGGGGGGAGTGGCGCCCTACGGGAAGCATN
  5   1   2       bld Egg3 5g                         IMAGE:6868874.5p                                                                                       CAATTCCCCGGGCGGCGCCCTTTGTTCGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGAGGAGAGTTTGGCTGTGATGGAGACTCGCCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCNNGATAGAATAAGAAAGAAGCGAATGTGCCGCAGAACTCAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAAGAGACAGCGNAANGGCTGANGGACAGACAGGACAGACAGACAAACTGTGTGAGGAAGAAGTGGGAAAGGAAATTCAGAAGGGAGATCCTGGGGGGAAAAGAACAGGGAGGGGGACCGGATGAAAATGAATTTGGTAAGCCACAGACTCTGGGGGACTCCCCTGGCACCCTCATTT
  5   1   2       bld Em10 5g                         IMAGE:7982560.5p                                                                                            CGGATGGCGGCGCCCTTTGTCCGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTCAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTTCCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACANGGAGGAGATTTTGGCTGTGATGGAGACTCGNCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACTCCCCAGATAAGAATAAGAAGAAGCGAATGTGCCCATACTCAATTGTCTGGCGCGTCCCGCTG
  5   1   2       bld Ooc2 5g                         IMAGE:3746377.5p                                                                                                  GGAATTCCCTTTGTCCGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCTCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGT
  5   1   2       bld Oo1  5g                         IMAGE:5080023.5p                                                                                                                 CGACCGTAGGTGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTCGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATAACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCGGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAACCTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGNAGGAGAGTTTGGCTGCGACGGAGACTCGCTCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAAGACAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAACTGTGTTGAGGAAGAAGGTGGGAAGAAAATCCGAAGGAGATCCCTGGGGGGAAAGAACAGGGNAGCCGACAGAATGAAATGAAATTTGGTACCCACCAGACTCT
  5   1   2       bld Emb9 5x                         IMAGE:7975572.5p                                                                                                                   CGTAGGTGTGCGCGCTGGGATGTGAGACTCTGTAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACTTTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCATGCCTGGGGCATGTTCTGGAGTTTATGTACACGGCACAGCTCAACCTGACCCGAGACTACGTAGAGTGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAAATTGTAAATGCCTGTACTGCCCTCAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACTTGCTTGGATAGTCTCACACTAGTGCAAGGTGATGTGCCTCTAGGGGAGGGAGCAGTTCCATACTCTGTTGATGATGGGAACTAAGTGGGGGAATGTGATGCAGTTCTGGTTTTGTTCCAGATGGCAGCCACATCATAGAATTTGGTGGAGGAAAACGACACATGATTTATATTCTAAGAAGAATTTTTGTTTGTATCAGACTCTCCTTCTGATGAACGGTTTCTCAATACTTGATTCCCTTTATAGATTTGAATGACTATTGCTCTAACCATTTTTGCTTTCTGCGCTTTTATGTTCTCTCAATTAA
  5   1   2       bld Oo1  5g3  out                   IMAGE:3404953.5p                                                                                                                           TGTGCGCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTCGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATAACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCGGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTC
  5   1   2       bld Oo1  5g                         IMAGE:6641192.5p                                                                                                                                GCGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTCGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATAACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCGGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAACCTGTGTGGAGGAAAGCGACACGAGGGCCGATGATCACAGGGNAGGAGAGTTTGGCTGCGACGGAGACTCGCTCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGGTGAANGAGGAGGTTGGGAAGGAAAAATCAGAAGGAAGATCCCTGGGGGGAAGAGAACAGGGAANGGCGNACAGGATGNAAAATGAAATTTTGTAACCCACAGGACTTCTGGGGGGACTCCCCTGGCAACCCTTCATT
  5   1   2      seed Ooc3 5g                         IMAGE:3472703.5p                                                                                                                                 CGCTGGGATGTGAGATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCG
  5   1   2       bld Sp1       out                   IMAGE:4964160.5p                                                                                                                                             GAGATCAGATCCGGTCCGGGATCTCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCAACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCACTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGT
  5   1   2       bld Ooc3 5g                         IMAGE:3472702.5p                                                                                                                                              GATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAG
  5   1   2       bld Ooc3 5g                         IMAGE:3472701.5p                                                                                                                                              GATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTAC
  5   1   2       bld Ooc3 5g                         IMAGE:3472669.5p                                                                                                                                              GATCGGAGCCGATCCCGGAATGGCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCGACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCGCTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGC
  5   1   2       bld Emb1                            IMAGE:6634922.5p                                                                                                                                                     AGCCGGTCCGGGATCTCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCGGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCAACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCACTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGGCGCAGGGAGAGGGAGCAGTTCCAGGCTCTGCAGAGAATGATGGGAACAGAGTGGGAGAATGTGATGAGGCTGCAGTAATATACCAGCATGGTCGGCACAGTGAGGAAACCCGTGTAGAGGACCCCCCAGATGTGGATAAGAAAGAAGTTGGAGTGAGAGCGGTGCCCCAGAACCAATCAGCCTGGCACGTCCCTGCTGGGGAGAAGGAAACAGGACTGGCCGAGGAGATATTGGCCGGACAAGCGAAGGCTGAGGCTTCAGCAGGTGGGAGGGACTCCTGCAGCAGGACAAACAGACGAGCTGTGTGAGCAGGAGCAGGAGCAGGAGGGAGGACAAACTGAGGAAGATCCCCGGGAGAGAGAATAAGGGAGCCGACAGATGAAAAATGAATTTCGTAGCCACGGGACTCTTGG
  5   1   2       add Ga12      out                        XL200f03.5p                                                                                                                                                      CTGAGCCGACGCCTCGTCCATGGATTTCCCTCANCACAGTCACCTGGTTCTAGGAGCAGCTCAATCANCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCNACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCNAC
  5   1   2       chi Ga15      out                      XL456l09ex.5p                                                                                                                                                                 ATCTCAGCCATGGATTTCCCTCAGCACAGTCACCTGGTTCTGGAGCAGCTCAATCAGCAGAGGCAGTTGGGGTTGTTGTGCGACTGCACCTTCGTGGTGGACGGGATCAACTTCAAGGCCCACAAAGCCGTGTTGGCCGCCTGCAGCCAGTACTTCCGCATGTTGTTTGTGGAGCAGAAGGATGTGGTGCATCTGGATATCAGCAACGCCGCAGGTACCGCCCACCCCATGACATCACTTCCTGTACCCACTGTCTGTGGCATCAGCTCATCCGACTGTTCTGTTTGTCAGGCCTGGGGCAGGTTCTGGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTAGAGGACGTCCTCACTGTGGCCGGATTCCTCCAGATGCAGGAGATTGTAAATGCCTGTACTGCCCTGAAATCTCTCAGTATTACCCCCGGGGCAACTGCCACCTGCCTGGAGAGTCTCACACCAGTGCAGGGTAAGTACTGGGGGAGATTGGATTCACTTACCCGGTGGGAGGTTCCTGTCTGACCATGGGAAAGAGAACAGCCCAGGAGCAGGAAGTACAGAGAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGAGATTGGATTCACTTACCCAGGGGGAGGTTCCTGTCTGACCATGGAAAAGAGAACAGCCCAGGAGCAGGAAGTACAGANAATCANAGCTCTGTACCTGGGTAAGTACTGGGGGAGATTGGATTCACTTACCCAGGGGGGAAGGTTCCTGTCTGACCATGGGGAAAANAAAACANCCCCANGAANCAGGAANTACANAANAATCNNAGCTCTGTACCTGGGNAANTACTGNGGGANATTGNATTCCCTTANCCCAAGGGGAAGGTTCCTGTNTGACCCNTGGNNAAAAAANAACANNCCCANGNANCANGAANT
  5   1   2       bld Ga15      out                      XL461e01ex.5p                                                                                                                                                                                                                                                                                                                                                                          AGCAACGCCGCAGGCCTGGGGCAGGTTCTCGAGTTTATGTACACGGCACAGCTCAGCCTGACCCGAGACAACGTATAGGACGTCCTCGCTGTGGCCGGATTCCTCC
  5   1   2       bld Em10                            IMAGE:8321164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCACCTGCCTGGAGAGTCTCACACCAGTGCAAGGTGATGTGCCTCAGGGGGAGGGAGCAGTTCCAGACTCGGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGAGGAGAGTTTGGCTGTGATGGAGACTCGCCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGTGAGGAGGAGGTGGGAGGAGAATCAGAGGAAGATCCTGGGGGAGAGAACAGGGAGGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCG
  5   1   2       bld Tbd7      out                        XL051j05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGCAGTTCCAGACTCTGTTGATGATGGGAACAGAGTGGGGGAATGTGATGCGGCTCCGGTTTTGTACCAACATGGCGGCCACAGCGAGGAAAACTGTGTGGAGGAAAGCGACACAAGGGCCGATGATCACAGGGAGGAGAGTTTGGCTGTGATGGAGACTCGCCCTGCGGAGGAGACGGTTCTCTCAGACCAGCATGAAGACCCCCCAGATAAGGATAAGAAAGAAGCGAATGTGCCGCAGACTCAAGTTGTCTGGCGCGTCCCGGCTGCAGAGAAGAGTGCGGCACCCACAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGTGAGGAGGAGGTGGGAGGAGAATCAGAGGAAGATCCTGGGGGAGAGAACAGGGAGGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAAC
  3  -1   2       bld Bla2                            IMAGE:7296378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTTCTCCGACCCCGCAGAGGAGAGACCAGCGAAGGCTGAGGGACAGACAGGACAGACAGACAAACTGTGTGAGGAGGAGGTGGGAGGAGAATCAGAGGAAGATCCTGGGGGAGAGAACAGGGAGGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAGGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGACGCCCGCTACCGCTGCAGCGACTGCAACAAACACTTCACCACCGCCGGCAACCTGAAGAGGCACCAGCTGGTCCACAGCGGAGAGAAACCGTATCACTGCGAGTTCTGCAACCGCCCCTTCTCTGACCCCACCTCCAAAATGCGCCACTTGGAAACGCACGACACCAACAAGGAGCACAAATGCCCCCCACTGCGACNAGAAGTTCAACCAACTGGGAAAACCTGAAGCCCCACT
  5   1   2       bld Ooc1                   IMAGE:3746836-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAACTGTgtgaggaggaggtgggaggagaatcagaggaagatcctgggggagagaacagggagGCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAAGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGATGCCCGCTACCGCTGCAGCGACTGCAACAAACACTTCACCACCGCCGGCAACCTGAAGAGGCACCAGCTGGTCCACAGCGGAGAGAAACCGTATCACTGCGAGTTCTGCAACCGCCCCTTCTCTGACCCCACCTCCAAAATGCGCCACTTGGAAACGCACGACACCAACAAGGAGCACAAGTGCCCCCACTGCGACAAGAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAACGGACGGACCCCTGAAATGCAGAGAATGTGGGAAGCAATTTACTACTACAGGGAACCTTAAGAGGCACCTGCGCATTCACAGCGGTGAGAAGCCATACGTCTGCGTCCACTGCAAGAGGAAATTTGCGGATCCGGGAGCTCTGCAGCGACACGT
  5   1   2       bld Ooc2      out                   IMAGE:3746836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        aggaggaggtgggaggagaatcagaggaagatcctgggggagagaacagggaggCGACAGATGAAAATGAATTTGTAGCCACAGACTCTGGGGACTCCCTGCACCCTCATTCTGATGCAACTCCCTACGGAGATCGGAATGAGTCCAGGCCCTACGGCTCCACCACTCACACGTGTAAGTTCTGCGGCAAAGAATTCACCCACACGGGCAACTTCACCAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAAGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCCCTGAAACCGTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGATGCCCGCTACCGCTGCAGCGACTG
  5   1   2       bld Brn2                             Brn2-zb05f05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGACACATTCGCACCCACACAGGGGAGAAACCGTTCACCTGCCGGGAGTGTAATAAAGCTTTCTCCGACCCCGCGGCCTGCAGAGCTCACGAGAAGACTCACAGCCCGGTGTTATTTTACGGCTGCGAGGACTGCGGGAAGAGCTACCGCCTGGTGAGTCTCCTGAACCTGCACAAGAAGCGCCACACGGGTGACGCCCGCTACCGCTGCAGCGACTGCAACAAACACTTCACCACCGCCGGCAACCTGAAGAGGCACCAGCTGGTCCACAGCGGAGAGAAACCGTATCACTGCGAGTTCTGCAACCGCCCCTTCTCTGACCCCACCTCCAAAATGCGCCACTTGGAAACGCACGACACCAACAAGGAGCACAAATGCCCCCACTGCGACAAGAAGTTCAACCAACTGGGAAACCTGAAAGCCCACCTGAAGATTCACATAACGGACGGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)