Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5085442.5                      17 END     3          17       17                (no blast hit)
     2   2.0    0Xl3.1-XL056e24.3                            5 END     1           5       20                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012771869 Xl3.1-IMAGE:7982655.5 - 17 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7982655.5                                        TGTCGCTGTTACTTGTTCTCCCCCTCCTAGAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTTTTCTCTGTGAAGCCACATTTTCCAACATGAGCCTCATGA
                                                  Xl3.1-CHK-1012690859                                              TGTTACTTGTTCTCCCCCTCCTAGAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTTTTCTCTGTGAAGCCACATTTTCCAACATGAGCCTCATGAAGCCAA
                                                      consensus depths                                             2     3     2     3     2     3     5     8     6    10     7    10     7    11     8    11    11    13    13    14    13    14    12    14    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    13    14    15    15    15    15    15    15    16    16    16    16    15    16    16    16    15    16    16    16    14    16    14    16    14    16    14    15    12    14    13    14    12    14    11    13     8    11     7    10     8    11     8    11     6     9     6     9     4     9     4     9     4     9     4     9     4     8     3     6     2     4     2     4     2     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                        --A---------
                                               BLH ATG     174     984                                        
                                               BLH MIN     174     114                                        
                                               BLH MPR     156     114                                        
                                               BLH OVR     174      44                                        
                                               CDS MIN     174     114                                        
                                               EST CLI      29      18                                        
                                               ORF LNG     174       1                                        
  5   1   2       bld Ooc1 5g3  out                    Ooc1-db27a06.y1 GGGTCGACCCACGCGTCCGGCTCCGCCTCTTTCTCTCCCTGTCGCTGTTACTTGTTCTCCCCCTCCTAGAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTNTCCGTATATATGACATGGACAAGGATGGCTACATCTTCAATGGTGAGCTCTTTCCAAGTCCTGAGATGATGGTGGGAAACAATCTCAAAGACACTCAAGTACAGCCAATAGTAGAACAAAAC
  5   1   2       add Ga12 5x3  out                        XL206a22.5p                            CTCCGCCTCTTTCTCTCGCCAGTCGCTGCTGCTCGTTCTCTCCCACCTAGAAGCTGCGGGTCATTGTACAACCGCCTTGTGCGCGGAGGCTGAGTCTTGTCCCGAGGGGAATACGGAAATTGCCGGGGATTCCCGAGGCCGACCAGTGAGCTGTGACAGTGAGGAGAGCGCCGCTCAGCCGCCAACATGGGAAATGAAGCAAGCTATCCATTGGAAATGTGCTCACATTTCGATGCGGACGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAGCTGGATTTAGACAACTCCGGTTCGTTGAGTGTGGAGGAGTTCATGTCGTTGCCGGAGCTTCAGCAGAACCCTCTTGTGCAACGAGTAATAGACATATTTGACACGGATGGAAACGGAGAAGTAGACTTCAAAGAGTTTATCGAAGGAGTGTCCCAGTTCAGTGTGAAAGGTGATAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATACGACATGGACAAGGACGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTGAAAGACACCCAGTTACAGCAAATAGTAGACAAAACCATTATCAACGCAGATAGAGATGGAGATGGAAAAATATCCTTTGAAGAA
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783076.5p                                     CCCTGTCGCTGTTACTTGTTCTCCCCCTCCTAGAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCA
  5   1   2       bld Kid  5x3                        IMAGE:7012409.5p                                                                 cccagcgtccgcggacgcgtgggcggacgcgtgggGCGCGCAGCCTGAGCCTTGTCCGGAGGGGCCGAGAGGAGCAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCTGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCGACGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACTATCTCAAAGACACTCGATTACTGCAAATAATAGACCAAACCTTTATCAATGCAGATCATGATGGGTATGGAGGATTATCTATTGAGGAATCTGTGCTGGCTTAGGACGCATATATATCCACAGAAGATGGTGGTGAATTGTGACCACTGGATAAGTCCCACACACTGTTTTCGTGCCATCTTGAAGATCTGCTCGACTCAATCATCTCTTGTGTTTTCATG
  5   1   2       bld Emb1 5g                         IMAGE:6635862.5p                                                                     GAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTAGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCCATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCCAAGACACTCAGTTACAGCAAATAGTAAGACAAAAACCCTTTATCCAATGGCAGAATAAAAGATTGGAAATGGAAAGAAATTATCTTTTTTGAAGAAATTTCTGGGGCTTGGCCCTAAGGAAGGGCTTTAAAATATCCCCCaaaaaaaaaTGGGTGGGGTGGGATTTTGGTTGACCCCCACCCCTGGAGAAAGAGCGCCCAAAAAAACACCTTtgggtttttctttttcttccatttccctggaaaaaatcttggtttccaaaaaaaggttccaagaaaaacgccctcctccgtgggggggaatttttttccaaaggggggaaagaaaatttttttCCCCCCCGGGGGGAGAAACCACC
  5   1   2       bld Em10 5x3                        IMAGE:7982655.5p                                                                     GAAGCTGCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCATTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCACACACTTGCTTCTTCTCATCTCTGAAGTCTGCTCAGACTCCAGCACGCTCTCTGTGTATTCATGGAGTATTTCTCGTGAGCC
  5   1   0       chi Emb1 5x3                        IMAGE:6865868.5p                                                                         CCTAGAAGCTGCGGGTCATTGTACAACCGCCTTGTGCGCGGAGGCTGAGTCTTGTCCCGAGGGGAATACGGAAATTGCCGGGGATTCCCGAGGCCGACCAGTGAGCTGTGACAGTGAGGAGAGCGCCGCTCAGCCGCCAACATGGGAAATGAAGCAAGCTATCCATTGGAAATGTGCTCACATTTCGATGCGGACGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAGCTGGATTTAGACAACTCCGGTTCGTTGAGTGTGGAGGAGTTCATGTCGTTGCCGGAGCTTCAGCAGAACCCTCTTGTGCAACGAGTAATAGACATATTTGACACGGATGGAAACGGAGAAGTAGACTTCAAAGAGTTTATCGAAGGAGTGTCCCAGTTCAGTGTCAAAGGTGATAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATACGACATGGACAAGGACGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTGAAAGACACCCAGTTACAGCAAATAGTAGACAAAACCATTATCAACGCAGATAGAGATGGAGATGGAAAAATATCCTTTGAAGAATTCTGTGTTGTCGTAGGAGGTTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACTGAGCAACACTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTTTTCTCTGTGAAGCCACAATTTCCAACATGAGCCTCATGAAGCCAACTTAGTGTTATTGAACttttttttttttttttGATCCTCTCAATAAACTCAGTGTAACACTTTTACAAGGCCTGGAAGGA
  5   1   2      seed Ga12 5g3  out                        XL198d05.5p                                                                           GCGGGTCAGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTAGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAG
  5   1   2       bld Tbd7 5x3                             XL054n16.5p                                                                              GTNNGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCATTGTCCCGAGGCACCGAGCAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTAGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGT
  5   1   2       bld Ga12 5g                              XL147c19.5p                                                                               GGTNGTCTACAACCGCTCTCTGCGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTAGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTA
  5   1   2       bld FaBN 5x3                        IMAGE:8078370.5p                                                                                                     CGCGCAGCCTGAGCCTTGTCCCGAGGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTAGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCACACACTTGCTTTCTTCTCATCTCTGAAATCTGCTCAGACGTCCACACGCTCTCTGTGTATTTCATGGAGTATTTTCTCGTGAGCACATTTCCACTGAGCTCAGAGCCACTATGTATGAA
  5   1   2       bld Gas8 5x3               IMAGE:3516585-IMAGp.IMAGp                                                                                                                             GGCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTT
  5   1   2       bld Gas8 5g3  out                   IMAGE:3516585.5p                                                                                                                              GCACCGAGAGGAACAGGGCGAGTGCCGGGGATTCCTGAGGCCGACCAGTCAGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACACAAAGATGGTGGTGGATGTG
  5   1   2       bld Tbd7 5g                              XL056c13.5p                                                                                                                                                   AGTGCCGGGGATTCCTGAGGCCGACCAGTCGCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAG
  5   1   2       bld Tbd7 5g3  out                        XL106a19.5p                                                                                                                                                                                 GCTGTGACAGTGAAGCGAGCGCCGCTCAGCCGCCACCATGGGAAATGAAGCAAGCTATCCACTGGAAATGTGCTCGCATTTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGGATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTC
  3   1   2       bld Egg1 5g3  in                    IMAGE:4783076.3p                                                                                                                                                                                                                                                                TTCGATGCGGATGAGATCAAAAGGCTGGGGAAAAGGTTCAAGAAACTGAATTTAGACAACTCTGGTTCCTTGAGTGTGGAGGAGTTCATGTCTTTGCCAGAGCTTCAACAGAACCCTCTTGTACAGCGAGTAATAGACATATTTGATACAGATGGAAATGGAGAAGTAGACTTCAAAGAGTTCATCGAAGGAGTGTCCCAGTTCAGCGTCAAAGGTGACAAGGAGCAGAAACTGAGGTTTGCTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTTTTCTCTGTGAAGCCACATTTTCCAACATGAGCCTCATGAAGCCAA
  5   1   2       bld Tad2                            IMAGE:6872443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTCCGTATATATGACATGGACAAGGATGGCTACATCTCCAATGGTGAGCTCTTCCAGGTACTGAAGATGATGGTGGGAAACAATCTCAAAGACACTCAGTTACAGCAAATAGTAGACAAAACCATTATCAATGCAGATAAAGATGGAGATGGAAGAATATCTTTTGAAGAATTCTGTGCTGTCGTAGGAGGCTTAGATATCCACAAAAAGATGGTGGTGGATGTGTGACCGACCTGAGAAGCGCCCAACACACTTGCTTTCTTCTCCATCTCTGAAGATCTGCTCAAGACGTCCAGCAACGCTCTCTGTGTATTTTCAATGGAAGTATTTTTCTCTGTGAAGCCACATTTTCCAACATGAGCCTCATGAAGCCAACTTAGTGTTATTGAAttttttttttttttttttttGATTCTCTCAATAACTTCAGTGTAGCACTTTAAACAGTCTGAAGGACAGCCAGATGGGGAAGAGCGCCTCCGTGTGGTGGTGAAAAGAAAAGGGAAGTTGGGttttaatttatttttattttttttCCCCTCATCTTTTATACCAGGAATATTTATATATAGGCTTTCTATGGAGTCATTAGGCGGGCTTTAATTTAATAGACTTGAGTCGAACCAAACTAGAGTACCAGGTGCCCAAGCAAAACATACCCCCGATCCAGGACATGGACGGGGGACCAATCCCTTTACTTTTAAGGGCCACCACCGGTTTTTTACCAAGGCAGGGAAAAAGGTCCGAATTTTTTTATTCCCCCCCGCCGGGGTCAAAATTGGCCCCCTTTTCGCCGGCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)