Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL086j13.3                           10 END     6          37       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8527944.5                       9 PI      91         22      461                (no blast hit)

 This cluster: approximate FL confidence score = 82%

 1012771908 Xl3.1-IMAGE:8071674.5 - 16 ESTs
                                                                       ........-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8071674.5                                                                               TCAGTCTCAGCCGCTCCTGTACCAGGGAACCACCATGTCTTTTGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAGCACAACCTGCAGCAGATAGACACCTTGGAGATTGTTGGAGATGTTGTCCTTCAATATGTACAAGTCTAGGAGTGGATGTATCATAGCATATATATATGACTTACATATCATATGAGCTT
                                                  Xl3.1-CHK-1012691226                                                                                     TCAGCCGCTCCTGTACCAGGGAACCACCATGTCTTTTGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAGCACAACCTGCAGCAGATAGACACCTTGGAGATTGTTGGAGATGTTGTCCTTCAATATGTACAAGTCTAGGAGTGGATGTATCATAGCATATATATATGACTTACATATCATATGAGCTTGCTTTG
                                                      consensus depths                                                                                    2     3     2     5     3     7     4     8     7     9     8    10     8    10     8    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    12    15    12    15    13    15    13    15    14    15    14    15    14    15    14    15    15    15    14    15    14    15    14    15    14    15    13    14    13    14    11    14     9    14    11    14    11    14    10    13    10    12     8    12     7    11     7     9     6     8     6     8     6     7     5     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                               BLH ATG      40     134                                                                               
                                               BLH MIN      40     111                                                                               
                                               BLH OVR      40      64                                                                               
                                               CDS MIN      40      25                                                                               
                                               EST CLI      16      25                                                                               
                                               ORF LNG      40       3                                                                               
  5   1   2       bld FaB                             IMAGE:8070040.5p TTGGTGGATTATAGCTTGTGGGTGCGGGATGCCCGGGATCCGGTGTAAGTACATTCACGTGAAGCCGGGACTTCAGTCGCAGCCGCTCCTGGTACGAGGGAACCACCATGTCTTTTGGGTGCGGTTAACAACCCTGCCTGTTCCCTTGGCATGTGCGCACTATCCCACGGTCTCGAAGATGGGTTTAGGCTGGTCATCAAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTGTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGAAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCGATCCACAGTTTTCTTCTGCTACATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACG
  5   1   2       bld FaB  5g                         IMAGE:8072142.5p                                                       GTACATTCACGTGAAGCCTTGACTTCAGTCTCAGCCGCTCCTGTACCAGGGAACCACCATGTCTTTTGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGAAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCANCAATCCCCAGCAGCCTGGAATGCTCCTCAGCATCCCACCTGGAGTGCATTCATCCACATTTCTTTGCTCATTTCGCCACAGCTATGAATCCCTACCAACTATATCACGAGTCTGTTCCTCAAGAGATGTCATCCAGA
  5   1   2       bld Tail 5g                         IMAGE:8543792.5p                                                       GTACATTCACTTCAAGCCTTGACTTCAGTCTCAGCCGCCCCTGTACCAGGGAACCACCATGTCTTTCGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACAGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTTCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCACAGCTTTATGAATCCATACCAACTATATCTACGGAGTCTGTTCCTTCAAGACGATGTCATCACAGAACGTACTGCAACCAAAAAGGTCATATAACTCAATTCATGTGGACACATACCTTNACCGAGTTGAGATGCCATGAC
  5   1   2       bld FaB  5g                         IMAGE:8070311.5p                                                                                         CGCCCCTGTACCAGGGAACCACCATGTCTTTTGGTCCAATTAACAACCCTCGTGTTCCCTTTACATTGCCACTATCCCAGCGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGAAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCGACCACAAGCTTATGAAATTCCCTACAAAACTAGTATCTACGGAGGTCTGTTTCTTTCGAAGACGATTGTCA
  5   1   2       bld Sp1  5g                         IMAGE:4968821.5p                                                                                           CCACGCGTCCGAGGGAACCAGCATGTCTTTTGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCCTG
  5   1   2       bld FaB  5g                         IMAGE:8072325.5p                                                                                            CGCTCCTGTACAGGGAACCACCATGTCTTTTGTTCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTCCAAGACGATTGTCATCACANGAAACGGTTACTGCAACCAAA
  5   1   2       bld Tbd7 5g3  out                        XL097m01.5p                                                                                              TGCAGGCAATTCGGCACGAGGGTCTTTCGGTCCAATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGCCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGGACGATTGTCATCACAG
  5   1   2       bld FaB  5g                         IMAGE:8072148.5p                                                                                                        GGGAACCACCATGTCTTTTGTTCCATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTCCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCCAAGCTTATGAATCCCATACCAACTATATCTACGGGGTCTGTTCCTCCAGACGATGTCATCACAGACGGTACTGCAACCAAAAGGTTCTATAACTCAATTCATGGTGACGCA
  5   1   2      seed FaB                             IMAGE:8071674.5p                                                                                                                               AATTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACA
  5   1   2       bld Neu7      out                        XL039j18.5p                                                                                                                                 TTAACAACCCTCCTGTTCCCTTTACATTGCCACTATCCCACGGTCTCCAAGATGGGTTTATGCTGGTCATCAGTGGAGTTGTCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACG
  5   1   2       bld Tbd7      out                        XL086j13.5p                                                                                                                                                          TTGCCACTATCCCACNNACTCCAAGNATGGGTTTATGCTGGTCATCAGTGGAGTTGCCACTGCTTCAGGAGACAGGTTTAATATAAACTTTCAGTGTGGTCAGTCTTCGAACGATGATGTTGCCTTTCATTTCAACCCCCGTTTCATTGATGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGA
  5   1   2       bld Sp1                             IMAGE:4969094.5p                                                                                                                                                                                                                                                                                          GATATCGTCGACCCACGCGTCCGGGCGGAATTGTTGTGTGCAACACCAAAGAAAGTCAGAGCTGGGGGAGGGAGGAAAACAAACGGGAAATGCCTTTTCACAGACATCAGCCTTTTGAGATCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCAC
  5   1   2       bld FaBN                            IMAGE:8078675.5p                                                                                                                                                                                                                                                                                                                                                                                                                  TCCGGATCCTTGTTACTAACCACAGTTACAAAGTTTCTGTGAACAGGAATCACTTTGTGGAATACCATCACCGAATCCCAATACAAAGGGTCAATACAATGACCATAGGTGGATGCATTACCTTAACATGTGTCCATGTAGAATCGCAAGGGGGTGGCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAACACAACCTGCAGCAGATAGACACCTTGGAGATTGTTGGAGATGTTGTCCTTCATATG
  5   1   2       chi FaB       out                   IMAGE:8069979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGATTATAGATTGTTCGGTCAAGGATTCCCGAGGATTCCGATACAAAGGGTCAATACAAGGACGCGTAATGTGGATGCGTGTACCTTAAGAGTGTGTCGCATGTATAATCGCAAGGGGGTGGCGTTCCCCTCTCAGCAGTTCCCTGAGTGCAGCAGTGTTCAGTCCCCAGCAGCCTGAAGATACTGCTCAGACATTCCCACCTGGAGTTGCATTCAATCCCCAACACCCTTGATATGCTCCTCAAGCATTCCCACCTGTAGTTGCATTCAATCCACAGTTTTCTTCGGCTCTATTGCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCGAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAACACAACCTGCAGCAGATAGACACCTTGGAGATTTTTGGAGATGTTGTCCTTCAATATGTACAAGTCTAGGAGTGGATGTATCATACCATATATATATGACTTACATATCATATTAACTTGC
  5   1   2       bld FaB       out                   IMAGE:8070441.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTGATGATTATAGAGTGTGGTCCAGATTCCGGGATAATAGAAGAGGGTCAATGCAATGACGAGTAGGGTGGATGCATGAGCGTAACATGGGTCCGTGGTGGAATCGCAAGGGGGTGGGGTGCGCGCTCTCAACAAGGCGCTGGTGCAGCGAAGGTGGAGTCCGCAGCAGCCTGGATATGGTCCTCGAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCGGCTCCATTGCAGCGACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCGAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAGCACAACCTGCAGCAGATAGACACCTTGGAGATTGTTGGAGATGTTGTCCTTCAATATGTACAAGTCTAGGAGTGGATGTATCATAGCATATATATATGACTTACATATCATATGAGCTTGNCTTGAACAGTA
  5   1   2       bld Lmb1      out                   IMAGE:8532453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAGAACCGAATATAATCGTCCCCTTCCCCTCTCAACAGTTCCCTGGTGCACCAATGTTCAGTCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCCCAGCAGCCTGGATATGCTCCTCAAGCATTCCCACCTGGAGTTGCATTCAATCCACAGTTTTCTTCTGCTCCATTTCAGCCACAAGCTTATGAAATCCCATACCAAACTAATATCTACGGAGGTCTGTTTCCTTCCAAGACGATTGTCATCACAGGAACGGTTACTGCAAACCCAAAAAGGTTTCATATAAACCTCAAATTCCATGGTGGAACAGCATTACACTTTAACCCGAGGTTTGATGAATGCGCAATTGTACGAAACAGTCACCTTAATGGCAGCTGGGGCAAAGAAGAGCGCGATCTACCAAGCGGGATGTGCTTTGTGCCAGGACAGAGCTTTGTGATTCAAATTAGATGTGAGCAACACGCCTTCAAGGTGAACATGAATGGAACCCAAATATGTGAATTTCATCACCGTGAGCACAACCTGCAGCAGATAGACACCTTGGAGATTGTTGGAGATGTTGTCCTTCAATATGTACAAGTCTAGGAGTGGATGTATCATAGCATATATATATGACTTACATATCATATGAGCTTGCTTTGAACAGTATATGGTTGCTATAGCTTATTAGACTGCATCTTATTTCATATTTCATTTCAGAAGTGTACAGAGGCACTGATTATGGTTGACTGACATACTTNATTCTAACATATGATGTGAGCACATATGCTTCATAAAAGAGTCACTGAATACTAAGTAGAGAGCGTATATCGAACATGAAAGAATATCTGCTTTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)