Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7207716.5                       7 PI      90          5      759                hypothetical protein LOC735008 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012771979 Xl3.1-IMAGE:7206328.5 - 18 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     4     5     5     6     7     7     7     7     7     8     7     8     8     9     8     9     8     9     8    10     9    10    11    12    12    13    12    13    12    13    12    13    12    13    13    14    13    15    13    15    13    15    14    16    14    16    12    16    14    17    15    17    16    17    16    17    16    17    15    17    16    17    16    17    16    17    16    17    15    17    15    17    14    16    15    17    14    16    15    16    14    15    14    15    14    15    14    15    13    15    12    15    12    14    11    14    11    14    11    14    11    14    11    14    10    13    10    13    10    13    10    13     8    12     8    12     7    11     6    10     6     9     5     8     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           A-----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN -== Ce ==== 5e-058     NP_498121.1 yeast HydroxylAminoPurine sensitivity related (20.5 kD) (hap-1) [Caenorhabditiselegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Os ---- 7e-061     NP_001064763.1 Os10g0457500 [Oryza sativa (japonica cultivar-group)] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 8e-064     XP_001184472.1 PREDICTED: similar to putative oncogene protein hlc14-06-p, partial [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- ?? ==== 2e-067     XP_637700.1 inosine triphosphate pyrophosphatase [Dictyostelium discoideum AX4] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 1e-070     NP_608890.1 CG8891-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ag ==== 4e-071     XP_317079.2 ENSANGP00000019707 [Anopheles gambiae str. PEST] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-084     NP_001093456.1 hypothetical protein LOC557834 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 2e-086     NP_258412.1 inosine triphosphatase; Inosine triphosphatase-A [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 7e-088     XP_422234.1 PREDICTED: similar to Inosine triphosphate pyrophosphatase (ITPase) (Inosine triphosphatase) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 5e-088     XP_851574.1 PREDICTED: similar to inosine triphosphatase isoform a [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-088     NP_080198.2 inosine triphosphatase; nucleoside triphosphate pyrophosphatase [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bt ==== 3e-089     NP_001069750.1 inosine triphosphatase [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 4e-113     NP_001089939.1 hypothetical protein LOC735008 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7206328.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA------------TAA------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld He1       in                    IMAGE:4408564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTGCAGCCGGCAGGAGTATAGTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCAGATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCAAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGT
  5   1   2       bld Egg1                               PBX0095B07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGTATAGTTCTTTGTAACCGGGAACGCTAAAAAGCTGGAAGAGGTTGTTCATATTCTTGGAGACAAATTTCCATGCAAATTAGTAGCCAAGAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTNAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAG
  5   1   2       bld Egg1      in                    IMAGE:4783430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAGACAAATTTCCATGCAAATTAGTTGTCACCAAAATTGACCTGCCAGAGTATCAAGGAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTATATTTTTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAA
  5   1   2       bld Ga12      in                         XL142c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAATTGACCTGCCANAGTATCAAGGAGAACCANATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCT
  3   1   2       bld Ga18      in                       xlk64f16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAACCAGATGAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGANNNNNAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGNTTATGTATAA
  5   1   2       bld Egg1                               PBX0135F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATTTCCATTCAGAAATGTAGAGAGGCAGCAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAAGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACAT
  3   1   2       bld Egg1      in                    IMAGE:4783430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGATACTTGCTTGTGTTTTAATGCATTGGGAGGTCTTCCTGGACCCTATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATACAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTCCATAAAAAAAAAAAAAAA
  3   1   2       chi Neu7                                 XL033k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGCTGCCCGTCTGTATCTGGCATATGCAAAGATGATTAATATCTTGTCGCCTAATTATTTTATTCTTTAGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACGTAAGCATTTATATGCAGGTTATTATGACGTATCAGATCCTCATAGCCGCAATTGGAACTGTTTACTGAAATCAGAAGGCAGATTATTTGATGTGACTCTCATTACAGTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCTGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAA
  3   1   2       bld Ga12      in                         XL142c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATATAAAATGGTTTCTTGAGAAGATCAAGCCAGAAGGNCTGCACCGAATGTTAGAAGGATTTGAGNACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGGAAATCNTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCTGACTACTTCNTCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTNAAGCATCCCTGTGTTTCTAAAAATGTTAC
  3   1   2       bld He1       in                    IMAGE:4408564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCTGCACCAAATGTTAGAAGTATTTGAGGACAAGTCAGCCATTGCCCTATGCACGTTTGCTTATTGCAATGAAAATCCTGATGATACAGTTCTTCTATTTAGAGGCAAAACCTTGGGACAAATTGTACTTCCCAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTAAAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCAAAGAAAGGCTACATTTGAGAGTTTTCATGAAGTACATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAAATTTTAATACTTTTACATA
  5   1   2       bld Ov1                    IMAGE:6318421-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGTTTCCAGCCGGATGGGTTTCAACAAACTTATGCTGAGCTCCCTAAAGAAGTGAAGAATACAATCTCCCACCGGTATCGTGCTTTAAAAGAAATGTCGGACTACTTCATCCAGAATGGCACGAAGGTTTGATGTTTCAACATCTATAGGTTTTCTGTGAAGCATCCCTGTGTTTCTAAAAATGTTACACAAAAACTTGGATGTCTGTGGTACTCCTTCCCCCCAGAAAGGCTACATTTGAGAGTTTTCATGAAGTGCATCACTACCTGTAAATGTTATGATGCTTATGTATAACTTAATAA

In case of problems mail me! (