Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012772133 Xl3.1-xl261m11.5 - 13 ESTs
                                                                       ....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl261m11.5     CTTGCTGGAAGCACCGCTGCCTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTTTATTGACTT
                                                  Xl3.1-CHK-1012692688           GGAAGCACCGCTGCCTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTTTATTGACTTGTTTGT
                                                      consensus depths          2     2     2     2     5     5     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     8     6     7     6     7     6     7     6     8     6     8     6     8     7     8     7     8     6     7     5     7     4     6     5     5     5     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     2     2
                                               BLH MPR      -4      50     
                                                                                                                                PROTEIN --- Ce ---- 4e-010     NP_500281.1 abnormal cell LINeage LIN-22, Helix Loop Helix containing protein,antero-posterior patterning factor, hairy and enhancer of split homolog (19.5kD) (lin-22) [Caenorhabditis elegans] ======================
                                                                       PROTEIN --- Dm ---- 3e-017     NP_476923.1 deadpan CG8704-PA [Drosophila melanogaster] ------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Ag ---- 4e-019     XP_316733.3 AGAP006699-PA [Anopheles gambiae str. PEST] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                     PROTEIN --- Ci ---- 3e-020     NP_001071685.1 transcription factor protein [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Sp ---- 3e-020     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Gg ---- 4e-021     NP_001005848.1 c-hairy1B [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Xt ---- 7e-026     CAJ82991.1 Helix-loop-helix DNA-binding domain protein with Hairy Orange domain, similar to hes1 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Mm ==== 4e-032     NP_032262.2 hairy and enhancer of split 2 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Hs ==== 4e-034     NP_061962.2 hairy and enhancer of split homolog 2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED - Cf ==== 8e-035     XP_849965.1 PREDICTED: similar to Transcription factor HES-2 (Hairy and enhancer of split 2) [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PREDICTED - Bt ==== 3e-039     XP_594586.3 PREDICTED: similar to hairy and enhancer of split 2 (Drosophila) [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PREDICTED = Dr ==== 1e-043     XP_001919504.1 PREDICTED: hypothetical protein LOC559147 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN === Xl ==== 9e-117     AAH92348.1 LOC495039 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl261m11.5                                     ATG---------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------------------------------------ATG---------------TAA---------------TGA------------------------------------------------------------------------------------------------TAG------------------------TAA---ATG------------------ATG---------------------------------------------TAATGA---------ATG---------------------TGA
                                                                   ORF                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Brn1                            IMAGE:7019485.5p  CTGCTTGCTGGAAGCACCGCTGCCTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGGACAAATAGTCCTGAATACAAAGGGGGCACGAGAGTGGACCCCCACATTGTGAACCCCAAAGGGGGTTTAANATCTAGTATGCGGATTTTGCATTTATTTTTTACATTTAAC
  5   1   2       bld Kid                             IMAGE:7011946.5p     CTTGCTGGAAGCACCGCTGCCTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATNGAATCCTGACTTTACTAAGGCATATATTTGGNACAAT
  5   1   2       bld Egg1                               PBX0114B07.5p                  CCGCTGCCTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATC
  5   1   2       bld DMZ       in                         xl261m11.5p                  GAGAGAACTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGG
  5   1   2      seed DMZ       in                         xl299k23.5p                  GAGAGAACTAGTCTGTACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCAC
  5   1   2       bld Egg1                               PBX0088C06.5p                                  GGCACGAGGCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCC
  5   1   2       bld Egg1                               PBX0145A02.5p                                    CACGAGGCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAG
  5   1   2       bld Egg1                               PBX0128B03.5p                                                     CGCTCGCAGACTCCATGCACAACTACCAGCCCAAGCCTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTTTAAAGCCCCTGATGGAAAAACGAAGGAGGGCAAGAATCAACGAGAGTCTGAACCAACTGAAAACCCTCATCCTGCCTCTCATTGGGAAAGATAATTCCCGGTACTCCAAGCTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCCTAAGAGACATCCCTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGG
  3   1   2       bld DMZ       in                         xl299k23.3p                                                                                                                                                                                                                                                 CTGGAAAAAGCTGATATTTTGGAAATGACAGTGAGATTCNTAAGAGACATCCNTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTT
  3   1   2       bld DMZ       in                         xl261m11.3p                                                                                                                                                                                                                                                         AAGCTGATATTTGGAAATGACAGTGAGATTCCTAAGAGACATCCNTCCGGTCCAGGCACAAAATCAAGCAGATCGCTACAAGGAAGGCTACAGAGCATGTGTAGAGCGTCTGAGCGCAATCCTTGGTAAATCTCATGTGCTGACCGGAGAGGCGAGTAACCGCCTTCTAGAATACCTGCAGAGGAGCCCTGAGCTGTGCAGTTCAGATTGTAATCATCCTCCCAAGCCCCAACGTCCTAGGATTGTGCTCCAAGTGAGTCCCAGAACATCTCAGTTTGGATCTCCTCTCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTT
  3   1   2       bld Egg6                            IMAGE:4434817.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAGAACCAACCCTCCAGCCACAGACCTGCCCCATGTCCCCCGCAGCTCAACAGCTCCATCTGGAGGCCGTGGTGAATGTCAGCTTGGACTTTGTACTCTCACAAAGACTGTGACAATGCTACAGCTCGTGGGCATTATTACCCCGTTATAAAACACCCCAGTGATATGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAAATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTTTATTGACTT
  3   1   2       bld Egg6                            IMAGE:4435542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCGAGCTCTAATAAGGTGACACTATAGAACCAGCGTGTATTTATTTATTGTAAATATGTCCCCTCACATGAAATCCTGACTTACTAAAGGCAATGTATTTTGGACAAATAGTCCTGAATACAAAGGGCACGAGAGTGACCCACATTGTGAAACCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTTTATTGACTTGTTTGTAAT
  5   1   2       bld Egg6                   IMAGE:4435542-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTGACCCACATTGTGAACCCAAAGGGTTTAATCTAGTATGCGATTTGCATTATTTTACATTAACCCATGGACTGCCAGAGATGGCCAATGCTACAGTCTCTGCCATGTATTGACTTTTCTGGCAGTCCAGGGGTTTAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACtttttttattgacttgtttgtaatgaaaaattatatttttaaaataaaatcctaaaatgtgaaaaaaaaaaaaaaaaCTCTCCAGTATTGGATCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)