Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6956818.5                      29 END     5          26       17                MGC80227 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6634366-IMAGp.5                16 PI      84        131      636                MGC81373 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012772209 Xl3.1-XL182m19.3 - 19 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL182m19.3                                                                                      TTTTTTTTTTTTACCAGCATTGAGCACAGGACTGAATGTTTATAGGAACTATGGCTGGCAAGGTTTTGTCTTCATTTTTGTTTTTTTACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGAAAAAA
                                                  Xl3.1-CHK-1012690053                                                                                            TTTTTTACCAGCATTGAGCACAGGACTGAATGTTTATAGGAACTATGGCTGGCAAGGTTTTGTCTTCATTTTTGTTTTTTTACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGAAAAAAAAAAAA
                                                      consensus depths                                                                                           2     2     3     3     3     3     4     4     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     8    12    12    12    12    11    13    13    13    13    13    13    13    12    13    12    13    13    14    14    14    17    17    17    17    17    17    17    17    17    17    15    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    17    14    16    15    16    15    16    14    16    15    16    12    15    11    15    12    15    12    15    10    12     8    11     8    10     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                      Xl3.1-XL182m19.3                                                                                                                                TAG---------------------------------------------TAG---ATG------------------------------------TAA---------TAA------------------------TAA---TGA------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------TAA------TAA---------ATG---------------------------------------------------------------------------TAG---TGA---ATG---------------------------TAA---------TGA------------------------------TAA---------------TAA------------------------TAA
  5   1   2       bld Egg3      in                    IMAGE:3378444.5p CCGGGttttttttttttttttttcttttttttttAATATAATGAATCAAACGAAGCCTACAAGGAAAAATGGAGAAGCCAGACttttttttttttttACCAGCATTGAGCACAGGACTGAATGTTTATAGGAACTATGGCTGGCAAGGTTTTGTCTTCAtttttgtttttttACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATTTTATACCCTAACAATGAGACCTTGATCACCATTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTG
  5   1   2       bld Gas8      in                    IMAGE:3516471.5p                                                                                      ttttttttttttACCAGCATTGAGCACAGGACTGAATGTTTATAGGAACTATGGCTGGCAAGGTTTTGTCTTCAtttttgtttttttACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGG
  5   1   2       bld Gas8                   IMAGE:3516471-IMAGp.IMAGp                                                                                                  ACCAGCATTGAGCACAGGACTGAATGTTTATAGGAACTATGGCTGGAAAGGTTTTGTCTTCAtttttgtttttttacttaggggatgaaaatctgttttttttCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAAAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGTTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTAAGAGTGATGCAGCTGTCCCTCCTGGCATGGCAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCCCAGTATTTAAACAAAAAGTAGTATTTAACCTAATG
  5   1   2      seed Tbd2                            IMAGE:3201148.5p                                                                                                                 AGGACTGAATGTTTATAGGAACTATGGCTGGCAAGGTTTTGTCTTCAtttttgtttttttACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTT
  3  -1   2       bld Ga12                                 XL181m19.3p                                                                                                                                 AGGAACTATGGCTGGCAAGGATTTGTCTTCATTTTTGTTTTTTTACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCANGAAACATGCTGNTAACTAATCCGCTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCANNCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGANCAGACGTCTAACCCNCNATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCATAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTNGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTANCCCTAGCTAACCTCTANCTATGACTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGNAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACNGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGAGTTTT
  3  -1   2       bld Ga12                                 XL182m19.3p                                                                                                                                 AGGAACTATGGCTGGCAAGGTTTTGTCTTCATTTTTGTTTTTTTACTTAGGGGATGAAAATCTGTTCTTTTTCTCCCCAGGAAACATGCTGTTAACTAATCCACTAACTGGACCCCAGTTATCTTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATANTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGAGTTTTACAATTAAAGTTCTGATTTATTGAATAAAAAAAAAAAAAACCC
  3  -1   2       bld Ga15      out                      XL480l06ex.3p                                                                                                                                    GACTATGGCTGGCAAGGTTTTGTCTTCATTTTTGTNTTTTTACTTAGGGGANGAAAATCTGTTCTTTTTCTCCCCAGGAANCATGCTGNTAACTAATCCACTAACTGGACCCCAGTNATCTTATACCCTAACAATGAGACCTTGATCANCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCANACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCANCAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCANCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGGNTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTNTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGCCNNG
  3   1   2       bld Gas8      in                    IMAGE:3516471.3p                                                                                                                                                                                                                                         TAACTGGACCCCAGTTATCTTATACCCTAACAATGAGGCCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTTTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGAGTTTTACAATTAAAGTTCTGATTTATTGAAAAAAAAAAAAAAAAA
  3   1   2       bld Emb4      out                   IMAGE:4957498.3p                                                                                                                                                                                                                                                            TTATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGA
  3   1   2       bld Tbd1                                 AW782428.3p                                                                                                                                                                                                                                                             TATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGAAA
  3   1   2       bld Emb4 5g3  out                   IMAGE:4957035.3p                                                                                                                                                                                                                                                             TATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGAGTTTTACAATTAAAGTTCTGATTTATTGAAA
  3   1   2       bld Emb4 5g3  out                   IMAGE:4959204.3p                                                                                                                                                                                                                                                             TATACCCTAACAATGAGACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTG
  5   1   2       bld Egg1                               PBX0125A09.5p                                                                                                                                                                                                                                                                              ACCTTGATCACCAGTCTCTCTCTTGTCTTCCTTGTAATAGTCCAACTTGTCCAGGAGCAGACGTCTAACCCGCTATCCTACAAATAACTCTGCTGCTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGGANaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Neu7 5g3  out                        XL012o05.3p                                                                                                                                                                                                                                                                                                                                                   CCGNTATCCTACNNATAACTCTGCTGNTACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGNTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGNTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAG
  3   1   2       bld Egg3      in                    IMAGE:3378444.3p                                                                                                                                                                                                                                                                                                                                                                              TACATCCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTCCCAATTAAA
  5   1   2       bld Ga15      in                       XL457i06ex.5p                                                                                                                                                                                                                                                                                                                                                                                   CCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL457i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                   CCTTATTGGACCAACAATATAATTTCACTACACCATAAGCCTCGGCACGGCAGCTATATTGGAAACGGGCAGCAGAAAATCCTCAAAGGGCTCTGCTAATTCTTATAATTGCTTGAAATGAACTTCTATGCTTTGGTAAGGGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGGAATGGTTACA
  5   1   2       bld Ga15      in                       XL413g13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTTAAACTAATGTGAATGTGTTTTACAATTAAAGTTCTGATTTATTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL413g13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATGGCTGCATTGTTGTTGCATTCTACCACCCACTTTAACCCTAGCTAACCTCTAGCTATGAGTGATGCAGCTGTCCCTCCTGGCATGGAAAGGGTAAACTTGGACCTGACTTGTTTCTCACTTCAAGCTCCACAGTATTTAAACAAAAAGTAGTATTAAACTAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)