Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8736443.5                     138 PI      81          1      780                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8735118.5                       4 PI      79          1      563                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012772258 Xl3.1-IMAGE:4969083.3 - 21 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4969083.3  TCCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATGTCAACAACCATGAATAAAACAACCTAAGGCA
                                                  Xl3.1-CHK-1012689582        TACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATGTCAACAACCATGAATAAAACAACCTAAGGCATCAGTC
                                                      consensus depths       3     3    11    11    11    11    12    12    12    12    12    13    13    16    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    14    17    16    17    16    17    15    17    16    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    18    15    18    17    19    16    19    16    19    16    19    16    19    17    20    16    19    16    20    17    19    16    19    15    19    15    18    15    18    15    18    15    18    14    17    15    18    15    18    14    18    14    17    14    17    13    17    13    17    13    17    13    17    13    17    13    17    13    17    11    17    12    17     8    17     7    16     7    16     7    16     7    15     7    15     7    15     7    15     7    15     7    11     7    10     7     8     7     8     6     8     5     7     5     5     3     5     4     5     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                      -------C----
                                               BLH ATG      35     740  
                                               BLH MIN      35     109  
                                               BLH OVR      35     142  
                                               EST CLI       1      75  
                                               ORF LNG      35       5  
  5   1   2       bld Panc 5g3  in                    IMAGE:8735986.5p GTCCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTTCCAGGAGTGTACGCTAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGAACAACTGATAGTAGAGCCACTGAGTGATTCTATCATAGTATAATATAACATGTACATCTACAGCGCCCAGAGTTCTCCTTCTTCCTCAGGTTATTATATCCATTATTCGGTACTGCACGTTCAACGTTACGATAGCCACAATAGTGAAATTAAATAATGGT
  5   1   2       add Panc      in                    IMAGE:8734757.5p  TCCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGAACAATGACCTTACAAAGGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAAAAACATCTATAAAACAACTTTAGCTACAAAGACAATGGCCTTTGAACCATGATTATCATGTTTGGTTAAACTAACAGAACCTGGCTTCAATATAACCAATATGGTTCAACCATCCCAGTTGCAGAAACTTGCCAAGAAAAGGGAACTAATGCTTGTGTCGGCTAGGAAACCTTCAAAAATAAAATCCCGATATATGCAGTGGGGAGTCAGTCGTTGATCCGTTAGGTCTATCCGATGATACGGAATTTCTGGCGCTCCTGAGCAGAATTCCAGTATCTGGCACACGCTGTAGTAACCTATAGGGCAAGGAGGCGGTTG
  5   1   2       bld Panc 5g                         IMAGE:8737444.5p  TCCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGGTGGATGTCCCAGTCCTGTTCAGACTCCAGCTGTAAGGCTTCATAATCTCCGGAATGATTACCGAGAAATATGTTCCTGTGCCGGCTTCCTGGAAGTGGAAAGGATTCATGGCAAGTTGAATCTGGGGGACCAATGGTCTGTAATGGAGACTCTTTGGAGTGTCTCATGGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGATGTACGCTTAAGTCTGCGACTATTCTCGGATTGGATGTCGGGACACTTAAGGACACTGGTATTGAAGACCTGGACTGATCATCAGGTAATAAACGTTACTTACGCGCTAGTCCTCCTCTCAGTATTATCATATCCGTAC
  5   1   2       bld Panc 5g                         IMAGE:8738921.5p   CCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGACACTGATAGTAGAGCACTGAGTGATCTATCATAGTATATATACATGTACATCTACAGCGCCAGAGTCTCTCTCTCAGTTTATTTAATATCATA
  5   1   2       bld Panc 5x3                        IMAGE:8738768.5p   CCAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCACTATCTGGATTGGATGCAGACATATAGAGACACTGATAGTAGAGCACTGAAGTGATCCTATCATAGTATATATAACATGTACATCTACAGCGCCAGAGTCTCTCCTCTCAGTTTATTTATATT
  5   1   2       bld Panc 5x3                        IMAGE:8736147.5p    CAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAAGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGAACACTGAATAGTAGAGCACTGAGTGATCCTATCATAGTATATATAACATGTACATCTACCAGCGCCAGGAGTTCCTCCTTCCCTCCCTCTCAG
  5   1   2       bld Panc 5g                         IMAGE:8737028.5p    CAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAAGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGACACTGATAGTAGAGCACTGAGTGATTCTATCATAGTAATATAATAACATGTACATCTACAGCGCCAGAGTCTCTCTCGTCAGTTTAATAATATCATTATTCCGGTACTGCAACTTTTTTTAACCG
  5   1   2       bld Panc 5g                         IMAGE:8736392.5p    CAGCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGACACTGATAGTAGAGCCACTGAGTGATTCTATCATAGTATATATAACATGTACATCTACAGCGCCAGAGTTCTCTTCCTTCCTCCAGGTTTATTTATATTCATTATTTCCGG
  5   1   2      seed Sp1  5g3  in                    IMAGE:4964889.5p      GCTACAGACTGAAAAATCAAGAAAACTTACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTA
  5   1   0       chi Panc                            IMAGE:8736794.5p       ACTCAATAAAGCGGCGCCTTGACTCTAAAGATCCATCGATTCCAATTCGTCCCGTTTCTGGGACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGGAAATACACTTTCAGATAATTGTAAAAATTCCCTGATATATTTGCAGTGGTGGTGGAATGTCCCAATCCCCGTTCTGGAccccccccTGTTAAGGGTTTTCTTTTCCCCCGAGTGGTTTTCCCCCAAtttttttttttttgcccccccttcccttcaaagggggggaaaaaaaaaaatgcccccctttattttttttgggggaaaaaggggtctttttttttgaaaaaacccccgcagagggggccccgggggcgcggggggtggcgtgttcccagtcccccccccaggggggcccccaaaacctcccccccaccttctttgtgtgttgggggggggTTGTATTAAGAAAAACCAAAA
  5   1   2       bld Sp1  5x3               IMAGE:4174016-IMAGp.IMAGp         ACAGACTGACAAATCAAGAAAACTCACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAAATAGCCAACAATAGTGATTAAATATGTTG
  5   1   2       bld Sp1       in                    IMAGE:4174016.5p           AGACTGACAAATCAAGAAAACTCACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCACTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAGGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACCAAGGAGGAAGGGACTTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGT
  5   1   2       bld Panc 5x3                        IMAGE:8738835.5p                               CTCACCATGATGCCTCTCTGGATACTATTGTTTCTGGCACTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAAGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGAACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTCAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATTTATACATGTACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTAATTTATAATCAATTATTTCCGTAACTGTG
  3   1   2       bld Panc 5g3  in                    IMAGE:8735986.3p                                                        TCAGACTACCATGAGTGCCTCTCCGATACTATGTTCTGCATGCAGCTGCTGCTCAATGATGAGATAGATGGGGAGGATTGAGTGCATCTCACTTTCAGCTGCAGTTTATTCACACAGAATGGCTGTCTTGTGGGGATCCTAATCACACCAAGGTGGATATTCTGCTGCTCATTGCTACCGGGCACCAAGACTTGGTTGCTCACGTGGGAGACAATGACGTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGAATTTAAGATA
  3   1   2       bld Panc      in                    IMAGE:8734757.3p                                                                       ATGATACGGGCACCTTGCAGTGTGCTCCACTGGATGATGATAAGATGTGGGAGATAGAGTGCATTCTTCACTTCAGCCTGCAGTTATTTCACACAGAATGCCTGTCTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACTTGGTTGCTCACCTGGGAGACAATGACTTTACAAAGGAGGAAGGGACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTTAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTACCACTCAACAACCAAGAAAAACCAACCTCTC
  3   1   2       bld Panc                            IMAGE:8734861.3p                                                                        CTGGCACCTGCAGCTGCTGCTCCTTCGGATGATGATAAGATGTGGGGAGGATAGAGTGCATCCTCACTTTCAGCTGGCAAGTTTATTTCACACAGAATGGCTGGTCTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACTTGGTTGCTCACTGGGAGACAATGACCTTACAAAGGAGGAAGGAACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTCAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATTCAACGAACCCTGAATTAAACTCAATACAT
  5   1   2       add Panc                            IMAGE:8737727.5p                                                                                   CTCCTCTGGATGATGATAAGATTGTGGGAGGATATGAGTGCATCCCTCACTCTCAGCCTTGGCAAGTTTATTTCACACAGAATGGCCTGGTCTTTTGTGGGGGATCCCTAATCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGGCACCCAAGACCTTGGTTGCTCACCTGGGAGACAATGACCTTACAAAGGAGGAAGGAACTGAGCAGCACATCCAAGTGGAGAACATCTATAAACACTTCAGCTACAAAGACAATGGCCTTGACCATGATATCATGTTGGTTAAACTAACAGAACCTGCTCAATATAACCAATATGTTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAAGGGAACTAATGCCTTGGTGTCTGGCTATGGGAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGGGGGATGTTCCAGTCCGGCTGACTCCAGCTGTAAGGTTCTATCTTCGGAATGATTACCGAGAATATGTCTGTGGCCGGCTTCCTGGAAGGTGGAAGGGATTCATGCAAGTTGATCTGTGGGACATGGTCTGGTAGGGAACTCTTGGAGTGGTCTCATGGGACGGCCTGGCATAGCGAGCTCAGAGTAGCTTAGTCGGCAATCTGATGAAGGGAAATGGACCGGATGAGGCCTGAGACTACGGTTACTGTAATTTCCCGCCTGAGGTTTTTCTCTCTAGAGTAAAT
  5   1   2       bld Sp1       in                    IMAGE:4969083.5p                                                                                                                                                                                                                                                                                                                                                                            ATATCGTCGACCCACGCGTCCGCGGACGCGTGGGATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATGTCAACAACCATGAATAAAACAACCTAAGGCAT
  3   1   2       bld Sp1       in                    IMAGE:4969083.3p                                                                                                                                                                                                                                                                                                                                                                                                          TGGGATAACCAATATGTTCAACCCATCCCAGTTGCAAGAAGCTGCCCAAGAGAGGGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATGTCAACAACCATGAATAAAACAACCTAAGGCATCAGTCTTAAAAAAAAAAAAAAAAG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4964889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACTAAATGCCTTGTGTCTGGCTATGGAAATACACTTTCAGATAATGTAAAATTCCCTGATATATTGCAGTGTGTGGATGTCCCAGTCCTGTCTGACTCCAGCTGTAAGGCTTCATATCTCGGAATGATTACCGAGAATATGTTCTGTGCCGGCTTCCTGGAAGGTGGAAAGGATTCATGCCAGGTTGATTCTGGTGGACCAATGGTCTGTAATGGAGAACTCTTTGGAGTGGTCTCATGGGGACGGGGCTGTGCACTAAGCGATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATCTGGATTGGATGCAGGACATTATAGAGAACAACTGATAGTAGAGCACTGAAGTGATTCTATCATAGTATATATAACATGTAACATCTACAGCGCCCAGAGTTCTCTTCCTCCTCCAGTTTATTATATCATTATTCCGTACTGCACTTTTTAACCGTATACGAAATAGCCAACAATAGTGATTAAATATGTTGTTCTATGTGTAAATGTCAACAACCATGAATAAAACAACCTAAGGCATCAGTCTTAAAAAAAA
  3   1   2       add Sp1       in                    IMAGE:4174016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAATATGTTCTGTCCCGGCTTCCTGGAAGGTGGAAAGGATTCATCCCAGGTTAATTTTGGTGGACCAATGGTCTGAAATGGAGAACTCTTTGGAGTGGTTTCATGGGGACGGGGCTGTGCACTAAGCAATGCTCCAGGAGTGTACGCTAAAGTCTGCAACTATTTGGATTGGATGCAGGCCATTATAAAGAACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)