Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8550666.3                       5 END     2          18       40                TBP1 [Gallus gallus]
     2   2.0    0Xl3.1-XL161g06.3                            2 END     1           9       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6324598.5.5                    29 PI      93         63      792                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:4677875-IMAGp.5                 6 PI      77        493      769                TBP-related factor 3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 93%

 1012772284 Xl3.1-IMAGE:3436361-IMAGp.5 - 11 ESTs
                                                                       -40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3436361-IMAGp.5                                         GGGTGAAATGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAGCTAGAAAATATGCCAGAGTTGTACAGAAACTGGGATTTCCAGCCCAGTTTTTTAGATTTTAAAATA
                                                  Xl3.1-CHK-1012695238                                               AATGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAGCTAGAAAATATGCCAGAGTTGTACAGAAACTGGGATTTCCAGCCCAGTTTTTTAGATTTTAAAATACAAAAT
                                                      consensus depths                                              2     4     6     7     7     8     8     8    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    11     9    11     9    11     9    11     9    11     8    10     8    10     8    10     7    10     8    10     8    10     7     9     7     9     5     8     5     7     4     6     4     6     4     6     4     6     3     5     3     5     3     5     2     4     2     4
                                                                   SNP                                                                                                                                                     -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                               BLH ATG     144     845                                         
                                               BLH MIN     138     112                                         
                                               BLH OVR     144      40                                         
                                               EST CLI     -17      16                                         
                                               ORF LNG     144       1                                         
  5   1   2       bld Thy  5g3  out                   IMAGE:8550666.5p GATATCTATTGAGGGTCCTCCCATAATCCAATTCGTCCCCGGGTGAAATGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGAAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAAACAATTGCACTTAGAGCGCGAATGCAGAGTATAACCCCAATAGCGTTTTGCTGCTGTTATAAATGAGTGATACGAGAGCCACGTACAACAGCGCTTATATTTTGGTCATGAAAAATGGTATGCCTGGGGCTAAAAGTGAACATCATCTCGTTTAGTAGCTTGATAATATGCCAGAGTTGTACAGAAACTGGGACTTCCGGCCAGTCTT
  5   1   2       bld Ov1  5g                         IMAGE:8331926.5p                             ATCAGTGGCGCCGGGTGAAATGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCNAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACGA
  5   1   2       bld Ooc3 5x3               IMAGE:3436361-IMAGp.IMAGp                                CTTGGAATTCCCCGGGATGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCAAACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAACAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAGCTAGAAAATATGCCAGAGTTGTACAGAAACTGGGATTTCCAGCCAAGTTTTTAGATTTTAAAATACAAAATATGGTGGGAAGCTGCGATGTGAAATTCCCTATCCGATTAGAGGGACTGGTCCTTACACATCAGCAGTTTAGTAGTTATGAGCCTGAGCTGTTTCCAGGTCTTATCTACAGAATGACCA
  5   1   2       chi Oo1                             IMAGE:6640262.5p                                      TTCGGATCGCCGGGTGAAATGGTGCAAAGTTAATAAGGCGAGTCGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCACGGAATTGTTCCTCAGCTCCGGAACATAGCGTCCCACTGCAAATATTGGCTGCAAACTTGACCTAAAGCCAATCGCACCGTAGATCGCCGAACTGGCCGAATATAACCCAAAAGGGGCTTGGGCGGCTGGGCTCCATGGGGGATACCCAGGGCCGAGAGAGCAACGGGCGCTGGTACTTACGGGCCGGGAAACATTGGTAGCGCGCCGGGGGCCCAAACGTGATGAACAACCCCCGCCGTAATCCACGAACAAGCGCCCGACTCTAGGCCGCAGAGACAATCCCGCGCATGTCTCAACACAAGGGTTCCCGGCGACTCATGGTGCGAGCAGTCTTACAGCAGGGCCAAAGATCCGCCAAGTAGTAAAACCCCCCCGTACGCGAATGTGAAGACGCCGAACGGGGCCGCTGGCGCGACCCANTAACCGGTCCGGCGCGCACCGCGGAGCGCGGACACACAGTTCGAACACGATCGCGCCGCGGGCGGGTCCACCGGTAAGAAAGAGAGAGAGCACACCGCCCCGAATGCC
  5   1   2       bld Oo1  5x3                        IMAGE:5085399.5p                                          CCGCGTCCGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAGCTAGAAAATATGCCAGAGTTGTACAGAAACTGGGATTTCCAGCCCAAGTTTTTAGATTTTAAAATACCAAAATATGGGTGGGAAAGCCTGCGATGTGAAAATTCCCCTATCTCGATTAGAGGGGACTGGGTCCTTTACACAATCAGCCAGGTTTACCAGCTTATGGAGCCCTGAAAA
  5   1   2       bld Egg1 5g                            PBX0115E03.5p                                              CACGAGGGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCACGACTTTTGTCTGCAGCTGGAATGGGTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGAAATCATGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCGAACTTGACCT
  5   1   2       bld Ooc3 5g3  out                   IMAGE:3436361.5p                                                 TGGTGCAAAGTTAATAAGGCGAGTCGGCGAGTGGCAGTCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCAAACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAACAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGGTATAATGAGGATACGAGAGGCACGTACAACTGCGCTTTATATTAGTTCAAGAAAAATG
  5   1   2       bld Ooc2 5g                         IMAGE:3746304.5p                                                            TAATAAGGCGAGTCCGCGAGTGGCAGTCAGTGTGAGTTGCAGCAAGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTGCCCAATAACTACAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCATGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTGAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAGATGCAGAGTATAACCCCAAGCGTTATGCTGCTGTTATAATGAGGATA
  5   1   2       bld Ov1  5g                         IMAGE:8331883.5p                                                                                CCCCGCGTCCGGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCAAACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAACAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAACTAAAA
  5   1   2      seed Ga12 5g3  out                        XL161g06.5p                                                                                      TCAGTGTGAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTT
  5   1   2       bld Emb1 5x3                        IMAGE:6636127.5p                                                                                             GAGTTGCAGCAGGACTTTTGTCTGCAGCTGGAATGGTTCATTTTAATTTGCAGAAATAGCACACCATTTTATTCTTTGTGGGATTTCCAATTGACACGACATGGATCAAAACAACAGCATACCCCCTTTCCAAGGGCTGGCATCACCACAGGGTTCTCTGACTCCAGGGATAAATATTTTCAGTCCATTGATAACCTATGGAACTGGTCTGACCCCCCAGCCTGTACAAACAACTAACAGTTTGTCAATACTGGAAGAACAGCAAAGACAACAGCAGCAGACGCAGCAGTCTACATTACAGCAAGGGAATCAGGGGTCAGGCCAAACCCCTCAACTGTTTCACCCACAGACTCTTACCACAGCACCTCTTCCAGGAAATACACCATTATACCCCTCCCCAATAACTCCAATGACACCTATTTCTCCTGCCACCCCTGCATCAGAAAGCTCAGGAATTGTTCCTCAGCTACAGAACATAGTGTCCACTGTAAATCTTGGCTGCAAACTTGACCTAAAAACAATTGCACTTAGAGCGCGAAATGCAGAGTATAACCCAAAGCGTTTTGCTGCTGTTATAATGAGGATACGAGAGCCACGTACAACTGCGCTTATATTTAGTTCAGGAAAAATGGTATGCACTGGGGCTAAAAGTGAAGAACAGTCTCGTTTAGCAGCTAGAAAATATGCCAGAGTTGTACAGAAACTGGGATTTCCAGCCCAGTTTTTTAGATTTTAAAATACAAAATATGGTGGGAAAGCTGCGATGTGAAAATTCCCTATCCGATTTANAGGGGACTGGGTCCTTTACACCATCAGCAGGTTTAAGCAGTTATGAAGCCCTGAACTGTTTTCCCAGGTCTTTATCTACCAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)