Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7008964.5                       7 PI      93       1187     1484                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6643435.5                       7 PI      89         95     1063                hypothetical protein LOC100158375 [Xenopus laevis]

 This cluster: approximate FL confidence score = 86%

 1012772302 Xl3.1-xlk75h19ex.3 - 43 ESTs
                                                                       .......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk75h19ex.3                                                                                                                                                                                                                                              TTGTGTGCCACGTAGAATTGGATACCGGTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTTCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGGACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACAGAGAAGGAGGAGGAAAAAGACCCAGGGAAGGATGGCGTGAGACAAAGAAAGAAAGGAAGTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCTGACAAACTATTCTCCTTATAATTATATCAGCCCACAAACTCTGTATGT
                                                  Xl3.1-CHK-1012686982                                                                                                                                                                                                                                                    GCCACGTAGAATTGGATACCGGTATTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATxxxxCAAAAGAGAAAATGGAACCTGTGCxxCxxxTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTTCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGGACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACAGAGAAGGAGGAGGAAAAAGACCCAGGGAAGGATGGCGTGAGACAAAGAAAGAAAGGAAGTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCTGACAAACTATTCTCCTTATAATTATATCAGCCCACAAACTCTGTATGTTTGCTG
                                                      consensus depths                                                                                                                                                                                                                                                   3     4     3     4     5     7     8     9    10    12    11    13    11    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    14     9    14     8    14     5    14     5    14     5    14     4    14     4    13     4    13     4    13     3    12     3    12     4    13     4    13     4    13     4    13     4    13     4    13     4    13     4    14     5    14     4    14     4    14     6    16     5    16     6    16     5    15     4    13     4    12     4    12     4    12     3    12     3    10     3    10     3    10     4    10     4     9     3     9     4     9     5     9     5     9     5     8     5     8     5     7     5     6     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     6     7     7     7     7     7     6     7     8     8     8     8     8     8     8     8     8     8     8     8     9    10     9    10     9    10     8     9     8    10    10    10    10    10    10    11     7    10     7    11     7    11     8    12     9    12     9    12    11    12    10    12    10    12    10    12    10    12    10    12     9    13     8    13     9    13    10    13     8    13    10    14    10    13     9    13     9    13     9    12    10    12    13    15    13    15    13    15    13    15    13    15    13    14    13    14    12    14    13    14    13    14    13    14    12    14    12    14    12    16    11    16    11    15    11    15    10    15     9    14     9    14     9    14     9    14     9    14     9    13     9    13     9    13     9    13     9    13     9    13     8    13     8    13    11    14    11    14    11    14    12    14    12    13    12    13    12    13    12    13    11    14    13    15    13    15    13    17    13    17    13    17    12    17    13    17    12    17    10    16     9    12     8    10     8    10     6     9     6     8     6     8     6     8     6     8     6     8     5     8     5     8     6     8     5     8     5     8     5     8     5     8     5     8     5     7     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     4     6     4     6     3     4     3     4     3     4     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                               BLH ATG      65     350                                                                                                                                                                                                                                              
                                               BLH MIN      65     162                                                                                                                                                                                                                                              
                                               CDS MIN      65       1                                                                                                                                                                                                                                              
                                               EST CLI      16       1                                                                                                                                                                                                                                              
  5   1   0       add Emb1                            IMAGE:6634069.5p GACGCAGGCACCGAAGCACGGCCCCGGCACGGCACAGCCCACGCAACCCGCGCACCCGACGCAACGCGACGCACGGACAGACCGAAGGCGCAAAAACAGCAGACGCACAACCAGCGGGGCCCCCCCGAACCAAGAAGGGGGGCTGGGTACCGGNTCCGGNAATTCCTGCGAAATCGGGCGACCACGCGTCCGCGTTTCTCCAGATTGTCTTTTCACGCGATATTTTGAACCGGATCATTGTGTGCCACGTAGAATTGGATACCGGTATTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACTATGTACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGNGTCAAAAGAAGAAAATGGGAACCTGGTGCCAACCTTTGGGACAATATGGCTTATATGTGCCCAACACCTCCCTGGATAATCAGGCCTGGGCTCCCCTTTTCGTTTCAATCCCCTTGTTTCCCCTGGAAATAACCCCTGGTGGCCCAGGTTCCCTAAAATAAGNCCAAAGGCCCCAAGGCCAACCCCAAGGGTTccccccccctgggccgttcccaaaaaaaaTTTTTAAACCCTTTCCCCCCTGTGGGAAAAAGGCCCCtttttttttgtggccccacaaattttccccaaaagggggggggccggtgaggggagncccccccctttttttcccccccttttttggggggggggaaaagggaaaaaattgggggcccccccccctttcgantttttttttttgggggggaaaaaacccccccttttttcccaaaattttccccccccccctttttcccaaatgggggggcgccaccccccttaaaaagaaaaaggggcccccccaccccacaaatttttttccccggggggggaaaaaccccccattgggggaaaaaaagcccccaagaagtttttggggccccaaagaaaaaaaggccccccgtgggggaaaaagggaaaaaaaaacccccccccccgtggggggggccccccaaccgggggggaaaaaacaaacctttttcctttcccaaatggggggggttccccaaaaaaaggggccccaacccttttccctcccaaaggaaaaaggggggatgggggtcttaaaaatttttggggggccccccttttttttggggggggtgccccccctttgggggtcgggggggAAAAT
  5   1   2       bld Int2 5g                         IMAGE:8824703.5p                                                                                                                                                                                  CGCCGCGGTTGATACCTAGGTATGCCACAAGATTAAAAATCGTCCCTTTGAACCGGATCATTGTGTGCCACGTAGAATTGGATACCGGTATTGTTGCACAGTGGTTGAAACAGGCTGGAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCGCATCATGGGCACAGCCATGGTCACCATGGACACGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGCAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGAACACTCTCATGGTCAAAGCCACCTCCCAGATGATGTTAGTTTGGCCTTTGGGTTCCTTGCCTTGAAATTATATTGCCC
  5   1   2       bld Emb4 5g                         IMAGE:4683725.5p                                                                                                                                                                                                            ATTCTTCCGAATCGTCGACCACGCGTCCGGATCATTGTGTGCCACGTAGAATTGGATACCGGTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCCAGTCCCTGCTCAAATTACTCCCTGAGACTTTGCATCAGGGGGGGCTTCCTTGGAGATGCCTTTTTTGCACCTCCATCCCTCATGCACTTAGAGCCACCTTTCTGGTACATGAAGCAGTTGGCAGAGCCCTGAAGGAAACAACATGGGCCACGGGACACTCCTCATGGGGCAAAAGCCACCTCCCCAAAATGATGTTTAAGTTGGGCCCTTTTGGGGTCCCTTGGCTGGGAAATTAATTGCCCCTTTTCTTTGTTTGGTTGGAAAAAATTTTCCCCGGAGGGCGCTTTTTTGAAAAGGGAAGAAAACT
  5   1   2       add Emb1                            IMAGE:6635016.5p                                                                                                                                                                                                                                   CCACGCGTCCGCCCACGCGTCCGGAATTGGATACCGGTATTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATNGGGCACANGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCANAAGAGAAGCACCAACTGGAGATATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTTNTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAAATACTCCCTGACCTTTGCAATCAGGGGGGCTTCCTGGGAGATGCCTTTTTTGGACCTTCATCCCTCATGGACTTAAAGCCACCTTTCTGGAACTTGAAACCATTTTGCAAAAGCCCTGaaaaaaaaCCAATTGGGCCCCCGGAAACCTTTTCCCTTGGGGTCCAAAGCCCCCTTTCCCCCAAAAGGAATGGTTAC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049325.5p                                                                                                                                                                                                                                                              CCACGCGTCCGGTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGTAAATGGAACCTGTGCAACTTT
  5   1   2       bld Ga18 5g3  in                        xlk2h06ex.5p                                                                                                                                                                                                                                                                TGGATACCGGTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGNCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAACCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCANNNNNTGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTNNATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTNNAGNNNNGAAGAAACACATNGNCNCGGACACTCTCATGGTCAAAGCCACTCCCAGANGATG
  5   1   2       bld Ga18 5g3  in                       xlk75h19ex.5p                                                                                                                                                                                                                                                                   GATACCGNGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAACCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCANNNNNTGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGNATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTNNANNNNNNAAGAAACACATGGCNNCGGANNCTCTCATGGTCAAAGCCACTCCCAGATGANGTTAGT
  5   1   2       bld Lmb1 5g                         IMAGE:8532315.5p                                                                                                                                                                                                                                                                        GGTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCAACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGAGTTGCAGAGCCTGAAGAACACATGGCCCGGACCTCTCATGTCAAGCACTCCAGATGAGTAGTGGGCTTTGGTCTGCTGATATGNCTTCTGTGTGAGATTGTAGCATGAAGAACTGACTGCCGACNTCTGCTCAGAAATTGATATCCGAAGGAGAGACCGAGTGTGACAAA
  5   1   2       bld Ov1  5g                IMAGE:5049325-IMAGp.IMAGp                                                                                                                                                                                                                                                                         GTGTTGTTGCACAGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATG
  5   1   2       bld DMZ  5g3  in                         xl240e10.5p                                                                                                                                                                                                                                                                                     AGTGGTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGTCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAACCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGA
  3   1   2       add Ga18      in                      xlk118d05ex.3p                                                                                                                                                                                                                                                                                      CCCACGCGTCCGGNCTGCAGGGAAANTGGNTCGNCTTTGGTTGAAAAGTGGTGTNGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATANCCATGCACATCATGGGNACAGNCATGGTCACCATGGACATGNCCACAGTCATCACGGACATGATTGCCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGTCATAGCCATGTGCATCATNGNACAGCCATCAAGATCACCATNGNACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGANNAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTNNNNNTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTCCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGNTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGNNGATNCAACAGAGAAGGAGGAGGAAAAA
  5   1   2       bld Ga18 5g3  in                      xlk128j19ex.5p                                                                                                                                                                                                                                                                                         GTTGAAACAGGCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGCCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCANNNNNTGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGNCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTNNATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTNTACATGAAGCAGTT
  5   1   2       bld Ga18      in                      xlk118d05ex.5p                                                                                                                                                                                                                                                                                                   GCTGCAGGGAAAATGGGTCGACTTTGGTTGAAAAGTGGTGTTGGTTGTGCCTTATTGGTAGCTATCTTCATGTTCTGTTGTTTGGTGCACACAGCCTTATCCCAGGCACATGAGGATTTTCATCATGGTCATAGCCATGCACATCATGGGCACAGCCATGGTCACCATGGACATGGCCACAGTCATCACGGACATGATTGCCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTTCACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAACATAGTCCAGATCATAAAGAGCNNNNNNTGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAANNACTCCTGAGCTTTNGNATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGNCACATTCTGTACATGAAGCAGTTNC
  5   1   2       bld Emb3                            IMAGE:3400688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCATGGACATGGCCACAGTCATCACGGACATGATTGCCATGGACACGGGCATTCCCATCATGGACATAGTCATGAGGATCTAAACCATGGTCATAGCCATGTGCATCATGGGCACAGCCATCAAGATCACCATGGGCACAGCCATGAGGAAATCCAGCATGAGCATAGTCCAGATCATAAAGAGCAGAGCCATGTAGTAGGAGAAGAGCGCACCAAAAGAGAAGCACCAACTGGAGATAATTTAATACACAATCATGGGTCAAAAGAGAAAATGGAACCTGTGCAACTTTGGACATATGCTATATGTGCCACACTCCTGATATCAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTANAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAA
  5   1   2       bld Tbd7                                 XL109o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACACTCCTGATATNAGCTGCTCCCTTCTTCATCCTCTTCCTGATACCTGTGCAGTCTAATAGCAGCCAGCACCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTTCTTGTTGTTGAGAAATTCGTGAGGCATTTGAAAGGAGAACATGGACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAAcagagaaggaggaggaaaaagacccaaggaaggatggcgtgagacaaagaaagaaaggaagTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGCTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTT
  5   1   2       bld Ga12      in                         XL178k20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGTCCCTGCTCAAATTACTCCTGAGCTTTGCATCAGGGGGGCTTCTTGGAGATGCCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTCCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACAGAGAAGGAGGAGGAAAAAGACCCAGGGAAGGATGGCGTGAGACAAAGAAAGAAAGGAAGTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCACGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACA
  5   1   2       add Egg4                            IMAGE:3743553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTCCCTTTGAGCACCTGATCCCTAATGCACTATAGCCACATTCTGTGCATGAAGCAGCTGCAGAGCCTGAATAAACACATGGCCACGGACACTCTAATGGTCAAAGCCACTCCCAGATGATGCTAGCTGGCCTTTGGGTCCTGGCTGGAATTATTGCCTTACTTGTGGATGAGAAATTAGCGAGGCATTGGACAGGAGAACATGGACATGGTCACGGACACAGGCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACAGAGAAGGAGGAGGAAAAAGACCCAGGGAAGGATGGCGTGAGACAAAGAAAGAAAGGAAGTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTTACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTACTACATGAAGAGCCTCATGAAATTGGGGACTTTGCTATCCTTGGGCAAGATGGATGCACATAGACGAAAGTAATGATGCTACAGCTCATTACAGCTTTTGGAGCACTGCATGCTACATTGGCTCTCTTTTTGGCTAATGAA
  5   1   2       bld Egg4                   IMAGE:3743768-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTTTTGCACCTCATCCCTCATGCACTAGAGCCACATTCTGTACATGAAGCAGTTGCAGAGCCTGAAGAAACACATGGCCACGGACACTCTCATGGTCAAAGCCACTCCCAGATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTTCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGGACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACagagaaggaggaggaaaaagacccagggaaggatggcgtgagacaaagaaagaaaggaagTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTTACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACA
  5   1   2       add Tail                            IMAGE:8545118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGACACTCTCATGGGCATAACCACTCCCACATGATGTTAGTTGGCCTTTGGGTCCTTGCTGGAATTATTGCCTTCCTTGTTGTTGAGAAGTTTGTGAGGCATTTAAAAGGAGAACATGGTCATGGACATAGTCATGCCGCAAAGGAAAGCCTAGCGGATGATGCAACAGAGAAGGAGGAGGAAAAGACCCAGGGAAGGATGGCGTGAGGCACAGAAAGAAAGGAAATAGCACTGCGCAGAAAGGCAAAAACAGCAAAAAGGAAGCCGTACAATCAGAAATGACTGTTTCTGGCTATTTAAATCTTGCTGCTGATTTCACCCACAACTTCACCGATGGACTAGCAATTGGAGCCTCATTCCTGGTCAGCAGCAATGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTTTGCTATCCTGGTACAAAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCGCTTGCTCTCTATTGGCAGAAGGAATTGGGGAAGCTGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTAATCCCAGAACTCCTGAAGGACTCGCGCCCTTGTNCATCCATCTTTGAGACCTTTGGAATCCTCCTGGGGTCGCTATGATGGTTCTATTGCACAGTTGAGTAGAGCCACTGCTGTAGGATGAGATCTGTGTCTTCANGACGTACATTTNCACTATTTTGCTAAGGTATGTCGAGTAGGATGGCGATTNACAGTTGCTCGCACATTGTGCTGGAAA
  5   1   2       bld Te2N                            IMAGE:7768081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAATTATTGCCTTTCTTGTTGTTGAGAAATTTGTGAGGCATTTGAAAGGAGAACATGGACATGGTCACGGACACAGTCATGCTGCAAAGGAAAAAATAGTGGATGATGCAACAGAGAAGGAGGAGGAAAAAGACCCAGGGAAGGATGGCGTGAGACAAAGAAAGAAAGGAAGTAGCACTGTGCAGAAAGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCACGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCTGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAG
  5   1   2       bld Tad2                            IMAGE:6932643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGCAAAAACGGCAATAAGGAACCACTACAATCAGAAATGACCGTTTCCGGCTATTTAAATCTTGCTGCTGATTTCACACACAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCACGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCCGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTNTGTACTTCTATTTACTAGGCAGTGTTTATTCTGCAATACTTTAATGTCCTTTGGGCATCTATTAACCCACAGTGGGAATACTGCAGAAGCTTTTAAAAGGGGAAGTTAATCTTAAAAAATACATTTTTAAGTATGGAATAGACAGTTCGGCTTAACATCTCACAAATCAGGGAAGT
  5   1   2       bld Brn1                            IMAGE:6953024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACTTCACTGATGGTCTAGCAATTGGAGCCTCGTTCCTGGTCAGCAGCAGTGTTGGAATTGTCACCACAATCACAATTCTCCTACATGAAGTGCCTCATGAAATTGGGGACTTTGCTATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCCAAAATCAGGGAAATATATAGTCCCCCTCATAAATCCTCCAAGGGGGGTGCCAGGGGAACTTAGACCCGGAAAAGCCTAATGAAATCCCAGGTTTTTAAGGTTTAAAAAAGGGAAACAAAATGGTGCGGGGGccccccccAACAGAACCAAACTGCGAAATTGTT
  5   1   2       bld Tbd7      in                         XL073a03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAATTCTCCTACATGAAGTGCCTCACGAAATTGGGGACTTTGCTATCCTGGTGCAGAGNGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGNTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGNCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGNTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTNAGGATGAGATCA
  3   1   2      seed Ga18 5g3  in                       xlk75h19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATNCTCCTACATGAANNNCCTCATGAAANTNGGGGNCTTTGCNNTCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATNCTACAGCTCAGTACAGCNTTGGGAGNACTTNCAGNNNCCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGNAGCCGCAACCTTATGGATTCTNCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTCGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTnnnnnnnnnAA
  5   1   2       bld Tad1      in                    IMAGE:6877864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGATCCTGGTGCAGAGTGGATGCACAAAGAGGAAGGCAATGATGCTACAGCTCAGTACAGCTTTGGGAGCACTTGCAGGCACCATTTGCTCTCTCTTGGCAGAAGGAATTGGGGAAGCTGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTCGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATCTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTGTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTGTGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTTCAAGTTTTAAAAAGTGAAACAAACATGTGCAGGCCCCACCCCACCAGACCAACTTGCAAATGTCTACACC
  3   1   2       chi Ga18 5g3  in                        xlk2h06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATNCTACAGCTCAGNNNAGNTTNGGNNNNANNNNCAGNCNCNATTNNCTNNNNNNNGCAGAANNANNNNGGAAGCCGCAACCTTATGGATTCTNCNNTTCACAGCAGGGGGATTTATTTATATTGNAACAGTTTCAGTTATCCCAGANCTCCTGAAGGACTCACGCCCTTTGCAGTCCATNCTTGAAACCTTTGGACTCCTCCTNGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTCGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGNGAAAATGTNTTNTTT
  3   1   2       bld Ga18      in                       xlk70h12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGTGGGCTTNNNNGGCACCATTTGNTNTCTCNTGGCAGAAGGAATTGGGGAAGCCGCACCCTTATGGATTCTNCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTNNTCCCAGAACTCCTGAAGGNCTCACGCCCTTTGCAGTCCCATCCTTGAAACCTTTGGACTCCTCCTNGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTNNANNNNNTTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTGTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAACATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATANTCCTGTGAAAATTTNTTTTT
  5   1   2       add Ga18      in                       xlk70h12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCATTTGCTCTCTCTTGGNAGAAGGAATTGGGGAAGCCNCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGANTCACGCCCTTTGCNGNCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGNCGCTATGATGGNTCTCATTGCACAGNTTGAGNAGAGNCGCTCACTGTNAAGNCAACAAACAGGGAAACATGTTGTGGAATTTTGGGNCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCNACCTATTTTTTCTAAAGATTATGTCATAGNTNGANATATCTGANATAACCTGTTGTTACTTCTATTTACTAGGNAGNGTTTATTCTNNNATACTTTAANGTCCTTGGGCATCTATNAANCACAGTGG
  3   1   2       bld Ga15                               XL492i16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTNGGCAGAAGGAATTGGGGGAAGCCGCAACCTTATGGATTCTGCCATTCACAGCAGGGGGATTTATTTATATTGCAACAGTTTCAGTTATCCCAGAACTCCTGAAGGACTCACGCCCTTTGCAGTCCATCCTTGAAACCTTTGGACTCCTCCTTGGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTGTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAACATGTGCAGGCAGACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGNGATAACTCCATCAATCTACCTAGCTGATATTCCTGNGAAAATTTGTTTTTGTTTCNTAAAA
  5   1   2       bld Ga14                               Ga14-p8h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGACTCACGCCCTTTGCAGTCCATCCTTGNAAACCTTTGGACTCCTCCTTGNGGGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGNAAACATGTTGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTGTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAAT
  3   1   2       bld DMZ  5g3  in                         xl240e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTCGCTATGATGGTTCTCATTGCACAGTTTGAGTAGAGTCGCTCACTGTAAAGTCAACAAACAGGGAAACATGTCGTGGAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGACATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTG
  5   1   2       bld Ga15      in                       XL459i04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCtttttgttttttattttGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL459i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTNGTAATTCCAAGATCGTTTTCAACCCTTTTnGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTT
  3   1   2       bld Ga15                               XL461i04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAATTTTGGGTCTCTGTAAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTGTTTCTAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5049325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGATGAGATCATGTGTCTTTCAGGGATGTACCTTTGCAACCTATTTTTTCTAAAGATTATGTCATAGTTAGATATATCTGATATAACCTGTTGTTACTTCTATTTACTAGGCAGTCTTTATTCTGCAATACTTTAATGTCCTTGGGCATCTATAAACCACAGTGGAATACTGCAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTATGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCATTCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGAAAAAAAAAAAAAAAG
  3   1   2       bld Tad1      in                    IMAGE:6877864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGTCCCTTGGGGCATCTATAAACCACAGTGGGAATACTGCAGAGCTTTTAAAGGGGGAAGTTAATCTTAAAAATACATTTTAGTATGGATAGACAGTTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAAATCTTCTGTGTGGTTGCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAACATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATGAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTCAGACTATCTTTCTTTAGACAAAA
  3   1   2       bld Ga18 5g3  in                      xlk128j19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGNCCTNGGGCANCTANNACCACAGTNGNATNCTNNAGAGCTTTTAAAGGGGAAGTTAATCTTAAAAATNNNTTTTAGTATGGATAGACAGTCGGCTACATCTCACAATCAGGGAGATATATAGTCTCCTCATAANTCTTCTATGTGGTTNCCAGGGACATAGACCTGAAAAGCTAATGAATTCCAGTTTTCAAGTTTAAAAAGTGAAACAAACATGTGCAGGCACACACAACAGNCCAACTGCAAATGTCTACACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAANCCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATTTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTAAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGA
  3   1   2       bld Ga12      in                         XL178k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAACATGTGCAGGCACACACAACAGACCAACTGCAAATGTCTACACNTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCNTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATTTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTAAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCGACAAACCATTCTCCTTATAATTATATCAGCCTACAA
  3   1   2       bld Tbd7      in                         XL073a03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCTTAGTAGAAGATATTATATCTATGATATATGTTTGTAATTCCAAGATCGTTTTCAACCCTTTTTGTTTTTTATTTTGGGACCAAAACCTGCAATCATGAGACCTACCATTTTTTTATTAGATCAATTGTGATANCTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATTTGTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAANTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGNGGGNTCAGAGCNGAGGNGTTGACTTCTNAGCAAGCGATGTAGACTGNAGAATGNATATGTAATGGGAAGAAAATAGGGAGCACTTTAATTAGGTTGTTGCTT
  5   1   2       bld DMZ                                  xl222l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTTTATTTTGGGACCNAAACCNGCAATCACNAGACCTACCATTTTTCTTATTAGACTCACATTGTGATAACTCCATCATTCTACCGTAGCTGATATTCCTGTGAAAATGTGNTTTTNGCTTTCTNNAAANAAATTAGATTTATNTTTNNNATATGANTNTGGGGTTATAANAAANTANTTGCTGGAACNTTNGTCAGANGTGTGGACTTCATTGGCCTTTTTACGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTACCACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGGNGTTTAANGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCTGACAAACTATTCTCCTTATAATTATATCAGCCCACAAACTCTGTATGTTTGCTGttttttttttgttttttttACAGGTNCTTTTTAGGGC
  5   1   2       bld DMZ                                  xl229d18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTTTTATTTTGGGACCAAAACCTGCAATCACGAGACCTACCATTTTTTTATTAGATCAATTGTGATAACTCCNTCATTCTACCTAGCTGATATTCCTGTGaaaatgtgttttttgttttcttaaaataaattagatttatttttttaatatgattttGGGGTTATAANAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTANAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATTAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCTGACAAACTATTCTCCTTATAATTATATCAGCCCACAAACTCTGTATGTTTGCTGTTTTTNTTNNGTTNTTNNNACCGGTTCTTTTNAGG
  3   1   2       bld Ga18      in                       xlk70m08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAATCATGAGACCTACCATTTTTTTTATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATGTGTTTTTTTTGTTTTCTTAAAATAAATTAGATTTATTTTTTTAATATGATTTTGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATGAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGAnnnnnnnnnCTGANAA
  5   1   2       bld Ga18      in                       xlk70m08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAATCATGAGACCTACCAttttttttATTAGATCAATTGTGATAACTCCATCAATCTACCTAGCTGATATTCCTGTGAAAATGTGttttttttgttttcttaaaataaattagatttatttttttaatatgattttGGGGTTATAAGAAAGTAATTGCTGGAACTTTTGTCAGATGTGTGGACTTCATTGGCCTTTTTAAGTGGGATCAGAGCAGAGGTGTTGATTTCTGAGCAAAGATGTAGACTGTAGAATGTATATGTAATGGGAAGAAAATAGGGAGACTTTAATGAGGTTTTGCTTTAAACAAAATGTGATGCTTGTGTTTAAGGGTATAGCTGTATTTGGGAAGTGTGGTGCGTGACACTAATGTATATATGGTATACAGATCACAGTGCTGACTGGCAGGTCCATTATTTGCTATCTTTCTGTATTCCTAAATTTCAGGAGTCATTGTTACAGATAATCTTTCTTTCTGACAAACCATTCTCCTTATAATTATATCAGCCTACaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)