Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk137n20ex.5                         2 END     2          11      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3400457-IMAGp.5                 6 PI      94          2      403                homeobox protein GBX-2b [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:4756878.3                       3 PI      95       1237     1363                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012772442 Xl3.1-xl329j14.3 - 17 ESTs
                                                                       ...-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl329j14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTGGATTCTGTTCTAGCCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACTCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAGGAGGCAGCCAGAAAGTTTGGAGCCCAAAGTCTCCATGGGGCCTTCGAAAAAAGTGATGGGAGTCAGTCAGAGGGAGAAGAAGGAAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCTGAAGCTTCTCTAGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTTAATAGG
                                                  Xl3.1-CHK-1012691002                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTGTTCTAGCCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACTCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAGGAGGCAGCCAGAAAGTTTGGAGCCCAAAGTCTCCATGGGGCCTTCGAAAAAAGTGATGGGAGTCAGTCAGAGGGAGAAGAAGGAAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCTGAAGCTTCTCTAGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     7     8     7     8     6     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     6     7     6     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     8     9     9    10    10    11    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    11    12    11    12    10    11    10    11     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9     9     9     9     6     7     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ce ==== 1e-015     NP_508796.1 C.Elegans Homeobox (ceh-1) [Caenorhabditis elegans] ====================================================================================================================================================
                                                                                                                             PROTEIN --- Ci ---- 2e-018     NP_001122328.1 transcription factor HB9 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Sp ---- 1e-019     NP_001009577.1 homeobox transcription factor Nk1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             REMOVED --- Dm ---- 4e-041     NP_477146.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ag ---- 4e-042     XP_308835.4 AGAP006923-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PREDICTED - ?? ---- 3e-049     XP_596545.4 PREDICTED: similar to Homeobox protein GBX-1 (Gastrulation and brain-specific homeobox protein 1) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 2e-085     NP_990399.1 gastrulation brain homeo box 2 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 2e-090     NP_694496.1 gastrulation brain homeo box 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 6e-101     NP_001476.2 gastrulation brain homeo box 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 5e-101     XP_543300.1 PREDICTED: similar to Homeobox protein GBX-2 (Gastrulation and brain-specific homeobox protein 2) [Canis familiaris] --------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 5e-101     XP_583937.2 PREDICTED: similar to homeobox protein GBX2 isoform 1 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 5e-102     NP_034392.1 gastrulation brain homeobox 2; stimulated by retinoic acid gene 7 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Xt ---- 2e-133     NP_001011472.1 hypothetical LOC496963 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 3e-143     AAI46639.1 Unknown (protein for MGC:160982) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl329j14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TGA---------------------------------------------------------------------------TAG------------------------------------------------------------------------------------ATG---------------------------------TGA------------------TAA------------ATG------------------------------------------------------------------------------------------------------TGA------------------------------TGA---------------------------------------------------------------------------------ATG------------------------------TGA------TGA---------------------------------------------TAA---------------------------------------TAA---------------TGA---------ATG------------------------------------------------------------ATG------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld Tbd1                                 AW765243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTGTCTCAAGCCACTCTGCAGTCAACTCTCTCTTCAGCGCACCACCACCACCCGATTCCTAGCTTGCCCGGTGGATTCTGTTCTAGCCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACTCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAGGAGGCAGCCAGAAAGTTTGGAGCCCAAAGTCTCCATGGGGCCTTTGAAAAAAGTGATGGGAGTCAGTCAGACGGAGAAGAAGGAAACAAGTCCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCTGAAGCTTCTCTAGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGANGAAAGCCCCCAAAACTCAAACCCTTCTAATAACAGCAACACCAGCTCCACAGGCAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGACTAGAGAAGAGTTCACTGNCAGAAGTACCTGTNCCTGACAGAGA
  5   1   2       bld Ga15      in                       XL516f05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCAGCTTGCCCGGTGGATTCTGTTCTAGCCTTGCCCAGGGCATGGCACTCACCTCTACTCTCATGGCTACTCTGCCAGGGGGATTCTCAGCCTCCACCCAGCACCAGGAGGCAGCCAGAAAGTTTGGAGCCCAAAGTCTCCATGGGGCCTTCGAAAAAAGTGATGGGAGTCAGTCAGAGGGAGAAGAAGGAAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCTGAAGCTTCTCTAGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGG
  5   1   2       bld Tbd7      in                         XL067k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTTGGAGCCCAAANTCTCCTGGGGCCTTCGAAAAAAGTGATGGGAGTCAGTCAGAGGGAGAAGAAGGAAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCTGAAGCTTCTCTAGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGAAGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTG
  3   1   2       bld Ga18      out                     xlk137n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNNNTNCCTNCCTGATGGACAGTGNCCTGGNCTACAGTTCAGATGANANNNNCTCCTGCCNANCTNNCCNNAANNAGNAGGANNCCCCAGANNNAAGCCCNNAANCTCAAACCCTTCTANNANCANNAACNCCAGCTCCACAGNNANNNNCGGCGGAGGAGAACTGCCTTCNCCAGTGANNAACTGCTGGAACTAGAGAAAGANTTCCNCTGCAAGAAGTACCTNTCCCTGACAGAGAGATCCCAGATTGNACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGNAGAGCCAAGTGGNAGAGGGTCAAGGCTGGCAATACGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCTATCCCAGTCCATGTCAATAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGTTCAATGAACAACAGCAGAGAAATCCATTCTGTGACCCTCAATTTGTTCAACAACTATCTCTCAGAATCCCTTGACAGATTAGATCGGTTGTAAAATTCTGTAGCTTCACAATGACAAGATCAAGAGTTGGGCATCCCTGGACTACACAACAATGAAAAGACTGAACCAGTTACCTTCAAGACTTTCAAGATACTGTTTATTATTCTAAATAGGGGTACCGTAACTTCTGCACTTGGGAGGCTTAATGTTAATTCCTCTTGGGCATTAAATGTATGTATAGATAAATTAAAAGTGGCCACTTTTTTTATAGGTGGTGAGCTAAACTTCTCCAAGTATCATTATAGTATTCTCCTGTTCTGGACTTGATATGGACAGAAGTATAGTGCGAGCTCTGGAACTGGACCAGGGGCCATGTTTCCTCATCCCGGCATCTTCTCCAGCTTCTGTTATTTTGNNNAAAAGCCCCTAATTTGAACAACAGACTTTTTTTTTAAATATTCCAAGAGTTTCAGATTATTTTGTGGTTAATTTATTCTGTTTCTTATTCTTATAAAATTTAAAATGTGAAAAANCATTCANNC
  5   1   2       bld DMZ       in                         xl270b07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGG
  5   1   2       bld DMZ       in                         xl246e13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCA
  5   1   2       bld DMZ       in                         xl240m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGA
  5   1   2       bld DMZ       in                         xl329j14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCTGCCAAACTGCCCACAAAGAGGAGGACACCCCAGAGGAAAGCCCCCAAAACTCAAACACTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGGCGGAGGAGAACTGCCTTCACCAGTGAACAACTGCTGGAGCTAGAGAAAGAGTTCCACTGCAAGAAGTACCTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATATGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGCAATGCGAACTCCAAAACTGGGGAACCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAA
  3   1   2       bld DMZ       out                        xl338m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCT
  3   1   2       bld Tbd7      in                         XL067k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCATACGNAGCCAACACAGCAGCTGGAGCAAGCAAGACCTTGAAATGGTCAATGAACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAAACTCAGTCTT
  3   1   2       bld Neu7                                 XL043f09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAAT
  3   1   2       bld Neu7                                 XL007h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCTACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTG
  3   1   2      seed DMZ       in                         xl329j14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCACACAATTAGAGGGTGGTGGAATTTGTAGCTTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACNTGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTTAATAGGGCA
  3   1   2       bld DMZ       in                         xl246e13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGAATTTGGTAGCTTACAACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATAAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTTAATAGG
  3   1   2       bld DMZ       in                         xl240m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGGTAGCTTTACCACAGTAATAGGGCCATAATATGGTCATCCCTGGACAATNAACAGATTAGCCATGGGTCAGACAATGGAGGTTGTTGGATGCCAATAACCAATTCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTT
  3   1   2       bld DMZ       in                         xl270b07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCTACTAGACTTTCCAGAATGACCCCAGTCCTGGTTATGTTAAGAAGAAGGGGTGATGTTTGCACTTGGGGAGGCAAAAAGGTTAATTCTTCAGGAACTTAATTTTAAGTGGTGGCAGGCAGAACCCCTCATAGCCATCTTAATTCTAATATTGTGGACTTGATACGGACAAAAGTCTAGTAAAACCCAAAACTGACCACAGAGTTGTGTTGCCTGCTATGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACTTAAAAAAACTCAGTCTTGTGAAATCTAATCATGTCTCTAATAAATAATTCCTTGCGGCCATTCTGGGATATTTGGGGTCATTCCAAAGCGCAGATGAAGAGCTTGTGTATAGGTCCCTGTTAATCTCCATCCAAACCCTGTGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTTTGGGATTTAATAGGG
  3   1   2       bld Ga15      in                       XL516f05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANGAAAAGTGCTGTGGGAGCAAAGTTAATTCCATAAGATGGGGGGTACATTCGGAAAAGATGATAACATCACCCCTTGGGGTACAATACCCTTGAACAAACTGAACTTGTTTTTCTAAACTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATATGTTATAAAACnAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)