Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xlk133n24ex.3                        16 PI      92         25     1087                myogenic factor 5 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012772562 Xl3.1-xl250e09.3 - 14 ESTs
                                                                       .......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl250e09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAACCAAAGGAACTCCTAAGAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGCTGTTTTCTTTCTAAAAAAAAAAA
                                                  Xl3.1-CHK-1012692558                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGGAACTCCTAAGAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGCTGTTTTCTTTCTAAAAAAAAAAAAAACTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 3     3     3     3     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10    10    11    10    12    10    12    10    13    11    13    11    13    11    13    11    13    10    13    10    13    10    13    10    13    10    12    11    12    11    12    10    11    11    11    10    11    10    11     8     9     7     8     7     8     7     8     7     8     6     8     6     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     5     7     6     7     4     5     4     5     3     4     3     4
                                               BLH ATG      85     937                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN      85     108                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR      85    1255                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               CDS MIN      85       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG      85      51                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-017     NP_001021893.1 Helix Loop Helix family member (hlh-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 3e-029     NP_001071955.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 5e-031     XP_001790150.1 PREDICTED: myogenin (myogenic factor 4) [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 2e-034     XP_001178452.1 PREDICTED: similar to Transcription factor SUM-1 (Sea urchin myogenic factor 1) [Strongylocentrotus purpuratus] -------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-035     NP_476650.1 nautilus CG10250-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN -== Dr ==== 1e-073     NP_571651.1 myogenic factor 5; myogenic regulatory factor 5 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 3e-087     NP_001025534.1 myogenic factor 5 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Cf ==== 6e-097     XP_852162.1 PREDICTED: similar to Myogenic factor 5 (Myf-5) isoform 2 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 5e-103     NP_032682.1 myogenic factor 5 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 7e-105     NP_005584.2 myogenic factor 5 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 7e-107     NP_776541.1 myogenic factor 5, transcription activator [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 6e-143     CAJ82544.1 myogenic factor 5 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 5e-151     NP_001095249.1 myogenic factor Xmyf-5 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl250e09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA---------------TGA---------TAA---------------ATG---ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------ATG------------------------------------------------------------TGA---------------------------------------------------------TAA------------------------------------TAA------------------------------TAG---------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld DMZ  5g                              xl262f08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAAAGCTAACCAAAGGAACTCCTAAGAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAGCGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTT
  5   1   2       bld DMZ  5g3  in                         xl252e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAACCAAAGGAACTCCTAAGAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTAT
  5   1   2      seed DMZ  5g3  in                         xl250e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTAACCAAAGGAACTCCTAAGAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTG
  5   1   2       bld Neu7 5g3  in                         XL017n17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATTTCCTGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGTCTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTG
  5   1   2       bld Neu6 5g                IMAGE:4084696-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTCCTCGAAACCTGATTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTC
  5   1   2       bld Neu7 5g3  in                         XL044i18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGAAACCTGNTTGCTTCAACTCCACTGAGCATCTTTCTAAGCAGCACTATTCAGAATGGAGATGGTAGATAGCTGCCATTTTTCCCCCTCTGAATTCTTCTATGACAGCTCTTGCATTCCTTCTCCTGAGGAGGGATATACAGAAGACTATGAGCATGGCATGTCCATCTATGGAGCTCACAAAAAGGACCTTGAAGAATCGGATGAAGACGAGCATGTCAGAGCACCTATTGGTCACCACCAGGCAGGTAACTGTTTGATGTGGGCTTGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGGTAAGAACCGACTGATTTCTAAATATATACTTATATCTTG
  3   1   2       bld DMZ  5g3  in                         xl250e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACCAGGCAGGTAACTGTTTGATGTGGGCTNGTAAAGCCTGCAAAAGAAAATCCTCCACCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAA
  3   1   2       bld DMZ  5g3  in                         xl252e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACAGACAGAAGGAAGGCTGCCACCATGAGAGAACGGAGAAGGCTAAAGAAAGTGAACCAGGCTTTTGAAACGCTCAAAAGATGCACCACTACAAACCCCAATCAGAGACTGCCCAAGGTGGAGATCCTGAGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCNNCAGCAAAAAAATACCAATAG
  5  -1   2       bld Bla2                            IMAGE:7296203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGCAGAGAAGCTGCACAGAGAGAGCGAGAGCTAAAGAAGTGACCAGCTTTGAACGCTCAAAGTGCACACTACAACCCAATCAGAGCTGCCCAAGGTGAGATCCTGAGAAATGCTATTCAATATATGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATtatttgtataaatatgtatataaagaaataatttgttattttgtaaatgcctaaattataattCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGCTGTTTTCTTTCTaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCCCCAAGTACCC
  3   1   2       bld Neu7 5g3  in                         XL017n17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAACGCTATTCAATATATTGAGAGTCTCCAAGACCTGCTGAGAGAACAGGTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGTCTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGC
  3   1   2       bld Neu4                            IMAGE:4084696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGATTCTCCAAGACCTGCTGAGAGCCCAGGTAGAAAACTCTACATTCTCCCAGGACAGAGCTGCCCCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGCCTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCTTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCCCCCCGTCTCCTACCAGAAGCACTGACTCCCTTCCGCGGTCCCCTGATGCGCATGAAAACCGACCAATCTCCCATGTGTTATAAGCCTCTCTTAATTCCATTACCATGTACATACTAGATATTAATCCAAGACATTTCCTTACCCCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAAGAAACTTTTTCTTTCTAAAAAAAAAATTTTAAGAAA
  3   1   2       bld Neu7 5g3  in                         XL044i18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAGGGGTTCCTTAGTGATTTTAGAAATTCTATAACAGTATATGGAATACATATATGTCTTGAGTTGCTAAAAAACAGTATTTGAATGCAAATAACACCAGATATATGTAAATGTAGAACAAGTATGCTTATACAACTGAATATGCTAAGTAAGTTTTTATTTTTCTTTTATAGGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATATTTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCNACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGCTGTTTTCTTTACNACGGTACNACTCCCT
  5   1   2       bld Gas8      in                    IMAGE:3517121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAAAACTACTACAGTCTCCCAGGACAGAGCTGCACCGAACCAGGGAGTCCCATGTCTAGCTGTTCAGATGGCATGACTGACTGCAGCAGCCCTCAATGGTCTGGAAGAAACAGCAGCATTTGATAATGTTTATTGCTCCGATCTACAGACAAGTTTCTCTTCAACCAAACTGACATTGTCCAGCCTTGACTGCTTATCTAGTATTGTGGATCGGATCTCCTCTCCTCAGCAATGCTCCCTCCCTATTCCAGACTCTATCACCCCGTCTCCTACCAGTAGCACTGACTCCCTTCCGCGGTCACCTGATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTATATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATT
  3   1   2       bld Gas8      in                    IMAGE:3517121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAGAAACAACAACTTTGATAATGTTTATTGCTCCGATCCAAAAACAAGTTTCTTTTCAACCAAAATGAACATTGTCCAACCTTGACTGCTTATTTAGTATTGTGGATCGGATTTCCTTTCCTCACAAATGGTCCCTCCCTATTCCAGATTTAATCACCCCGTTTTCTAACAGTAGAATGAATCCCTTCCGCGGTCACCTTATGCGCATGATTGCCGACCAATCTACCATGTGTTATAAGCCTCTCTTAATTCCATTAACATGTACATACTAGATATTAATCCAAGACATTTCCTTACACCCAACAAACCAGCGGATAAGGACTGATGTTATTATTTGTATAAATATGTATATAAAGAAATAATTTGTTATTTTGTAAATGCCTAAATTATAATTCTACTTGGCTGCATTTTGTATTTAACATAAATAACCAAACCTACAGCAAAAAAATACCAATAGCTATTGTGTTAATAAACATGCTGTTTTCTTTCTAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)