Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl313k15.5                            9 END     2           6       22                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:4930289.5                       6 END     1           3       16                Similar to collagen, type II, alpha 1 (primary osteoarthritis,spondyloepiphyseal dysplasia, congenital) [Xenopus laevis]
     3   2.0    0Xl3.1-IMAGE:4202402.5                       2 END     1           3       50                alpha-1 type II' collagen [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:8636148.5                     363 PI      76        252      925                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8741703.5                     118 PI      76        578      917                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:6874928.5                      75 PI      76        578      917                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:4724692.5                      17 PI      95         71     1248                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:6877717.3                      10 PI      94       1633     2257                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:5537445.5                       3 PI      92       1003     2049                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012772563 Xl3.1-IMAGE:8543895.5 - 31 ESTs
                                                                       -70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8543895.5                                                                       TCCCTGGTCCAATTGGTCCACCTGGTCCACGCGGTCGTAGTGGTGAAACTGGCCCAGCTGGTCCACCTGGTCAATCTGGCCCACCTGGCCCCCCTGGTCCTCCTGGTCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCTGACCCAATGCGCTACATGCGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTGAATAACCAGATCGAAAGCATTCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATCTTATCTGGG
                                                  Xl3.1-CHK-1012688009                                                                             GTCCAATTGGTCCACCTGGTCCACGCGGTCGTAGTGGTGAAACTGGCCCAGCTGGTCCACCTGGTCAATCTGGCCCACCTGGCCCCCCTGGTCCTCCTGGTCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCTGACCCAATGCGCTACATGCGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTGAATAACCAGATCGAAAGCATTCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATCTTATCTGGGGTATTT
                                                      consensus depths                                                                            2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     5     6     6     6     6     6     6     6     6     6     7     7     7     8     9     9     8     9     8     9     9     9     9     9     9     9     9     9     9    10     9    10     9    10     9    10    10    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11    11    11    11    11     9    11     9    11     9    11     8    10     8    10     8    10     8    10     8    10    10    11    10    11    10    11     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     8     9     8     9     8     9     7     9     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     9     8     9     8     9     8     9     8    10     9    10     8     8     8     8     8     8     8     8     8    10     8    10     8    10     8    10     8    10     7    10     9    10     9    10     9    10    10    10    10    10     9    10     8     8     8     8     7     8     4     7     4     6     4     6     4     6     4     6     4     5     4     5     6     6     7     7     7     8     7     8     8    10     8    10     8    10     8    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     8    10     8    10     9    12     9    12    10    13    10    13    10    13    11    13    11    13    10    13    11    12     9    12    10    12    10    12    10    12    10    11    10    11     9    11     9    11    10    12    10    12    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     8    10     9    10     8    10     7    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     5     7     5     7     5     7     5     7     3     7     3     6     3     6     2     6     2     6     3     6     3     6     2     3
  5   1   2       bld Brn3                            IMAGE:8538840.5p GCCGGTCCTTCTGGTCCTAGAGGTCCCCCTGGCCCTGTTGGTCCTTCTGGAAAAGATGGCTCTAATGGTATCCCTGGTCCAATTGGTCCACCTGGTCCACGCGGTCGTAGTGGTGAAActggcccagctggtccacctggtcaatctggcccacctggcccccctggtcctcctggtcctggAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCTGACCCAATGCGCTACATGCGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTCAATAACCAGATCGAAAGCATCCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAATGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCANGCACCTTNNAGAANGCTGTCTACTCCANNGATCATGATT
  5   1   2       bld Lmb1                            IMAGE:8534200.5p                                   GNGGAGCATCGAAAAAATTCGTCCCCTCTAATGGTATCCCTGGTCCAATTGGTCCACCTGGTCCACGCGGTCGTAGTGGTGAAACTGGCCCAGCTGGTCCACCTGGTCAATCTGGCCCACCTGGCCCCCCTGGTCCTCCTGGTCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCTGACCCAATGCGCTACATGCGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTGAATAACCAGATCGAAAGCATTCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCANGGCACCTTAAGAANGCTGTTCTACTCCAGGGATCNATGATGTAGAATCAGAGCTGAANGCACAGCAGATTCACTACATGCCTTGAAGATGCTGCAGAAACCAC
  5   1   2       bld Lmb1                            IMAGE:8535172.5p                                                                                       GTCACCTGGTCCACGCGGTCGTAGTGGTGAAACTGGCCCAGCTGGTCCACCTGGTCAATCTGGCCCACCTGGCCCCCCTGGTCCTCCTGGTCCTGGAATTGACATGTCTGCTTTTGCTGGCCTATCTCAACCTGAAAAAGGACCTGACCCAATGCGCTACATGCGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTGAATAACCAGATCGAAAGCATTCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGAACTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGA
  5   1   2       bld Tad1                            IMAGE:6937914.5p                                                                                                                                                                                                                                                         GGGTGCTGACCAAGCCTCTAGTTCTGTCCTTCAGACCGCTGATGTTGAAGCCAATTTGAAAACCCTGAATAACCAGATCGAAAGCATTCGCAGCCCAGATGGTACCAAAAAGAACCCAGCCCGCACATGCCGTGACCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCCAATGATGTAGAATTCAGAGCTGAAGGCAACAGCAGATTCCCTTACAATGCCCTTGGAAGATGGCTGCCAAAAACACACTTGGCAAATGGAACAAGACAGTTATTGAATTTAGGCACACAGTAAAAAATCCTCCCCCTGGCCATCCGTAGGACTTTGGCACCAATGGAATATTGGTTGGCGCTTTATTAGGGAATTTCGGGTGTTGGACCTTTGC
  5   1   2       bld Tail                            IMAGE:8543895.5p                                                                                                                                                                                                                                                                                                                                                                           GNGATACCTAAAAAATTCGTCCCTGAAACTCTGCCATCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTaaaaaccaaaaaaagcataataaaattaataaaaCCCTAAGGACCTGAGTACTTTCCATCACTTTTAGGACTCTGCACTGATGGCTGACCGACCCCAATTTCATCATCACGCGCTACATTTTGACTTTTTATTTGATTGCAGGCAGACTGGCAACGAAAATAATCACGTATATTATTATGTCTCTGAGACTATGTCAGG
  5   1   2       bld Tbd7      in                         XL057e10.5p                                                                                                                                                                                                                                                                                                                                                                               CGAGGGCACATGCCGTGACCTGAAACTCTGCCTCCTGAATGGAAGAGTGGTGAATATTGGATTGATCCCAACGAGGGCTGCACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAG
  3   1   2       bld Emb4      out                   IMAGE:4202402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTGCACTGTGATGCCTACCAAGTTCTTCTGCAACATGAGAACTGAGAGTCCTGGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCTAA
  5   1   2       bld Emb4                            IMAGE:4680217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTGTAGATGCTATCAAAGTCTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAAATTGGTGTTGACATTGGCCCAGTCTGCTTCTTG
  3   1   2      seed Emb4 5g3  out                   IMAGE:4959725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGTTTTCTGCAACATGGAGACTGGAGAGTCCTGTGTATACCCCAGCCCATCAAAGATCCCCAAGAAGAACTGGTGGACCGCCAAGGGCAAGGAAAAGAAGCACATTTGGTTTGGAGAGACAATCAATGGTGGTTTCCAATTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCT
  3   1   2       bld Ga18                             rxlk124h18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANGGGCANNNAAAAGAAGCACATTTNGTTTGNAGAGANAATCATGGTNGNTTCCAATTCAGCTATGGAGATGACAGCTCANNANCAACACTGCTAACATTCAGTTGNCCNTCNTGNGTCTGCTGTCCNCTGATGNNNCCCAGAACATCACCTATCACTGCNANGAATANCATTGCATTTATGGATGAAGCTTCAGGNAACCTTAAGAAGGCTNTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGNCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTNNAAAA
  5   1   2       bld Tbd4                            IMAGE:4058835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGTTCAGCTATGGAGATGACAGCTCAGCACCCAACACTGCTAACATTCAGTTGACCTTCCTGCGTCTGCTGTCCACTGATGCATCCCAGAACATCACCTATCACTGCAAGAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTaaaaaccaaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTATGGACTTTNTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTAT
  5   1   2       bld Neu7      in                         XL004h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATNCTGCAAGNAATAGCATTGCATTTATGGATGAAGCTTCAGGCAACCTTAAGAAGGCTGTTCTACTCCAAGGATCCAATGATGTAGAAATCAGAGCTGAAGGCAACAGCAGATTCACTTACAATGCCTTGGAAGATGGCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACATTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGG
  3   1   2       bld Tbd7      in                         XL057e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAAACCAAAAAAAGCATAATAAAAATAAATAAAACCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACANATATAAAAAAA
  5   1   2       bld DMZ                                  xl236p09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGCAAGAAACACACTGGCAAATGGAGCAAGACAGTTATTGAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGtaaaaaccaaaaaaagcataataaaaataaataaaaCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAGGGTTCTGTTGCANNAAACCNTGGAAATGACTGCTAATGCNNAANAAANTCANCTTATG
  3   1   2       bld Emb4      out                   IMAGE:4960227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATATAGGACACAGAAAACATCTCGCCTGCCCATCGTAGACATTGCACCTATGGATATTGGTGGCGCTGATCAGGAATTTGGTGTTGACATTGGCCCAGTCTGCTTCTTGTAAAACCCAAAAAAAGCATAATAAAAATAAATAAANCCCTAAGGACCTGAGTACTTTCCAATCACTTTTAGGACTTCTGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad1                            IMAGE:6939855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCACTGAATGGCTGAACCGACCCCAAATTTCCATTCATCCACGCGCTTACATTTTGGACTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCATGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAAGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAAGTGATTATCCTATGCCTTCTGGGTTCTGTATCCTGGGAGAAGACTGGAGAGGAAGGATCAAAGATTGGAGGATTCAATTTGAATGGGCCCAAAGGAAGTTAATTAATGGCGAGaaaaaaaaaaagttgcctggttttttttttGGG
  5   1   2       bld Brn1      in                    IMAGE:6949775.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGAATTCTTGGGATCTTTTTTATTTTGAATTGCAAGGCCAGAACTGGGCAGACTGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAAATCAGGTCATAGCCCATTCAAAAGAGACAATGTTNGTCTTCCAAATATGTATGTGAATTATCTACCCCTAAAATCT
  5   1   2       bld Tad2                            IMAGE:6933748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NCCGGGGAAAAATAAAATCACGGTATTATTTATTTATTGTCTTCCTGTAAGACCTATGGGTCAGGTGAAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGCAGCCCTCCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGGCaaaaaaaaGATTTGCTGTTTTTTTGGGTGGAACAACTAGAACAATGCCAAAGTTTTACCAACCTATTAATCTCAAATAAATTTCAGTTAATTGTAGGTAAGGCCCAATTGGGGTTGA
  3   1   2       add Ga18      in                      xlk103c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGTTTGAAACTAACTGGCATGTTTGAAGGCCCCCTAACTGTTGTACGAAGTGCAGTTTAAAGNANNCTCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGTAANNNANTTTTGTATTTTAAAAT
  5   1   2       bld Ga18      in                      xlk103c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAAACTAACTGGCATGTTTGAAGNCCCCCTAACTGTTGTACGAAGGCAGTTTAAAGCAGCCCTCCCCCTCACAGTGTATATCAACAGGAAAACTGTGTGTAATTGAATGAAATGGTGCTATTGTTGtaaaacagttttgtattttaaaatatcaactgatataaaaaaatctttttggaaagtaaaaaaaaaa
  5   1   2       bld Tad2      in                    IMAGE:6875666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGAATGAAATGGTGCTATTGTTGTAAAACAGTTTTGTATTTTAAAATATCAACTGATATAAAAAAATCTTTTTGGAAAGTACAAGTTGATCTGGGCTTTGTTCTTTTATATTTTTATATACTGTAGATTGAAAGAAAAAAATCCAGGATTGTCAGTCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAAGCAAGTGGTTGATGATGACAATTCGGGTCATAGCCATTCCAAAGAGACAATGTTGTCTTCCAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGGACCTTATTTTGCTGTGGTTTTGAGGAATTAAACAGTTAAACCACTTTGGCCCaaggggagggaagggggaaaccaaaaaagggattaaaaattcaaaaaataggacctattttttgaaaaaaattttttttttAAAAATTTCCCG
  3   1   2       bld Tad2      in                    IMAGE:6875666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCTTTTTTGGAAAAGTACAAAGTTGAATCTGGGCCTTGGTTCTTTTTATATTTTTAATATACTGTAGATTGAAAAGAAAAAAATCCCAGGATTGTCAGTCCCACCTGCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTG
  3   1   2       bld Brn1      in                    IMAGE:6949775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCCCCTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATAGAACTTTCTCAGGTTTAAGCTACCTCCCACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATTTTAT
  5   1   2       bld Tad2      in                    IMAGE:6874098.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTATTGTTGTGGTTTTTTCCAATATGAGATGAAGGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCCGCAATATGTACTATTTTGTATAGAAtttttttttACAATTTCGCAATACTTGATTTTTCCGGATAGTAGGTTAGAAAAACATGGCCCACACCCAACACTCAATCTTTTTTGCGGAAAAAATTTGGCCTTAACTGCCACCCTTTTTTCCCCGGTTTTCCCAAATCCTCCTTCCTTTTTCTGCCAATTAACAAACCTCCAAAGGCTTT
  3   1   2       bld Tad2      in                    IMAGE:6874098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAATATGAGATGAAGGGAAGTTTAGGGGCAATATTAGAACTTCCCCAGGTTTTAAGCTACCTCACACTAACTAAAAAAGGAAAGACAAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATTTTATGG
  5   1   2       bld Tbd2                   IMAGE:3200713-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAAttttttttAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTT
  5   1   2       bld Tbd2                            IMAGE:3200713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGTTTAGGGCAATATTAGAACTTCCCAGGTTTAAGCTACCTCACACTAACTAAAAACGAAAGACAAAAGTGAAATCTTGAAGCTGAACTAAACATGCAGTACTGTAGGAGTCAAAGAAACAGTGATTGATGGAACAATCTTGGGTTGCGTTCTCAAGTTCAGGTGATTATCTTATGCTTCTGGGTTCTGTATCTGGGAGAAGACTGAGAGGAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACAC
  3   1   2       bld DMZ       out                        xl273b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGAGGAAGATCNAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCNATAGTNTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCNGTGTTTTTGAGGATTAAACAGNTAGACACNTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAANATGTACTATTTTGTATAGAATTTTTTTTAAAATNTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCNGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAANAATAAAACACGTTTGTTTGANTTTTTACTTTGTANTAAATTCCATCCTATGATGTAATCTTTGTNGAACGATGTTAATC
  3   1   2       bld Neu7      in                         XL004h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGATCAAAGATTGAGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATNTAAGTATTTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATCTTATNCTGGGGTATTTCAGACAGAACGAAACAACACAAATAAAAC
  5   1   2       bld Tad2                            IMAGE:6875846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGATCAATTTGATGGCACAAAGGAGTAAATAATGGCGAAAAAAAGAGTTGCTGTTTTTTTGGTGGAACAACTAGACAATGCCAAAGTTTAGCAGCTATAGTCTCAATAAATTCAGTATTGTAGTAGGCAAGTGGTTGATGATGACAATTCAGGTCATAGCCATTCAAAAGAGACAATGTTGTCTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAAttttttttAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTaaaaaaaataaaaataaaaCACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAAATCTTTGTTGAATGATGTTAATCTTATCTGGGGTATTTCCTGACNGAACGAAACAACCCAAATAAAACTTTTANCTTN
  3   1   2       bld Tbd1                                 AW782450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCCAAATATGTATGTGAATTATCTACCCCTAACATCTAATTATCTCTGACCTTATTTTGCTGTGTTTTTGAGGATTAAACAGTTAGACACTTTGGCCAGAGGGAGGGAGGGGGAAGCAAAGAAGGGATAAGAATCAAGAATATGTACTATTTTGTATAGAATTTTTTTTAAAATTTCGCAATACTGATTTTCGGCATAGTAGGTTAGTAAACATGCCCACACCAACACTAATCTTTCTTGTGAAATAATTGTCTTACTGTATCTTTTTCTCGTTTTCCAATCCCTCTTCTTTTCTGCAATAAAGACTAAAAAGCTTTTTCTATTAAAAAAAAATAAAAATAAAACACGTTTGTTTGATTTTTTATTTGTATTAAATTCCATCCTATGATGTAATCTTTGTTGAATGATGTTAATCTTATCTGGGGTATTTCATGACAGAACGAAACAACACAAATAAAACTTTTAATTAAAAAAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)