Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6950410.3                       3 END     1           2       33                MGC84416 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7019288.5                       4 PI      93          1      771                MGC84416 protein [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:6950410.3                       3 PI      91        996     1333                MGC84416 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012772719 Xl3.1-IMAGE:6955650.5 - 39 ESTs
                                                                       .-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6955650.5                                                                                  TCTGTAGGAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGACGGCAGTATGACTCCAAAAAAA
                                                  Xl3.1-CHK-1012687243                                                                                        GGAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGACGGCAGTATGACTCCA
                                                      consensus depths                                                                                       5     6     5     7     9    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    11    12    12    13    12    13    12    13    12    13    12    13    11    12    12    13    13    14    11    13    11    13    12    14    12    14    11    14    10    15    10    15    11    15    11    15    11    15    11    15    12    17    12    17    12    17    12    17    11    18    11    18     9    18     8    18     9    19     8    19     9    19     9    17     9    17     9    16    10    17    10    18    10    17     9    16    10    14    12    14    12    14    12    13    12    12    12    12    12    12    11    12    11    13    10    14    12    17    12    19    11    19    12    20    13    21    13    20    16    21    16    21    16    21    16    21    16    21    14    21    14    21    14    21    14    21    13    20    13    20    13    20    13    20    13    20    13    20    13    19    14    18    13    18    13    18    12    18    12    18    12    18    11    17    11    17    11    17    11    17    11    17    12    17    12    16    12    16    12    16    12    15    12    15    12    14    12    14    11    15    12    16    12    16    12    15    12    15    12    15    12    14    13    15    13    15    11    15    11    15    11    14    11    14    11    14    11    14    13    16    13    15    13    15    13    15    13    15    13    15    13    14    13    14     9    14     9    14     7    14     9    14     9    14     9    14     9    14     9    14     7    11     5    10     4     6     4     5     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTAT
                                                                   SNP                                                                                                                                  -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G-----A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----C-C----
                                               BLH ATG     138    1282                                                                                  
                                               BLH MIN     123     216                                                                                  
                                               BLH MPR      33     216                                                                                  
                                               BLH OVR     138    1194                                                                                  
                                               EST CLI     -10       2                                                                                  
                                               ORF LNG     138      93                                                                                  
                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ==== 1e-082     NP_508183.1 ARRestin, beta 1, Drosophila kurtz homolog (48.5 kD) (arr-1) [Caenorhabditiselegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Sp ---- 2e-089     XP_001195887.1 PREDICTED: similar to beta-arrestin 1, putative [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 7e-096     XP_001255589.2 PREDICTED: similar to Beta-arrestin-2 (Arrestin beta 2) (Arrestin-3) [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Dm ---- 3e-102     NP_524988.1 kurtz CG1487-PA [Drosophila melanogaster] -----======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Ag ---- 1e-103     XP_317960.1 ENSANGP00000004989 [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-105     NP_001041447.1 arrestin [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 7e-133     XP_001337184.1 PREDICTED: arrestin, beta 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN --- Bt ---- 3e-147     NP_851343.1 S-antigen; retina and pineal gland (arrestin) [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 6e-153     XP_001231686.1 PREDICTED: hypothetical protein [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ==== 1e-155     NP_033144.1 retinal S-antigen [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 4e-156     XP_855579.1 PREDICTED: arrestin, S-antigen [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-157     NP_000532.2 S-arrestin [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          CAJ82949.1 S-antigen; retina and pineal gland (arrestin) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          NP_001081898.1 arrestin [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6955650.5                                                                                                                      TAG---------------------------------------------------------------------------------TGA---------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG------ATG------------------TGA------------TAA------------------------------------------------TAG------------------TAA------------------------------------------------------------TAAATG---------------------------------------------------------------------ATG---------------------------------------------TAA------------------------ATG------------------------------------------------------------------TAATAG---------------------------------------------------------------TAA---TGATGA---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       add Brn1 5g                         IMAGE:6953168.5p GAGAGGAGGAGAAAAGAGAGAAAGGAGAAGAAgggggggggCAGCTGGTCCGGTCCGGAATTCTCCGGATGGATATCTCAATCTGTAGGAGCTGCCTGGCATCGAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAAAGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGGAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAACCAGCTCCCTCAAAAGGGGGGCGAAGGGCTGTGGGGAGGAATTTTGGAAAGTAAGGCAGTTTTTCTACGGACAAATTTGAGAAAAGATAAAATTCCACAAGAAAGAAATGCTGGTCCCCGCTTTATGAATCCGGCAAAAATCGGTAATGGGCGGGAAGAATCAGCCCAGGGGCCCTAGACCCCCCGAACGCGAAGAGAATGGTGGGGGAGGATCAATGAATCGCGAGGGAAGAAGGCTTCTGGGAACCCGGAGGAAGCAATCAGCGACTCGAAAGAGGGGATGGTTTTTATTCACTGGGGGGGAGAGCAAATTCGCTGGGAGTCCGTGTGAAAGTGGGCGGAGCAGAAGAAAATCTCCGGAAAGAAAAAAGGGGGAAT
  5   1   2       bld Brn1 5g                         IMAGE:7019421.5p                                              GCTGGTACCTGGTCCGGGAATTCCCGGGGATCTCAATCTGTAGGAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTNGTGTCTGTCAGTGTGACCAACAAATCCCGACCAAACAGTGAAAGAAAATATCCTGCTTTCAGTGG
  5   1   2       bld Brn1 5g3  in                    IMAGE:6951442.5p                                                             GTCCGGATTCCGGGATTCTCATCTGTAGGAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAAGAGGTGTTTTTATCATGGGGAACCCAATCACTGTGTCCTGTCCGTGTGACCCAACAAATCCGACCAAACAGTGAAAAAAATATCTGCTTCAATGGAACCAGGGGAGTAATGTGGTCCCTGTATTTCCGCCA
  5   1   2       add Brn1 5g3  in                    IMAGE:6956932.5p                                                                        GCGATCTCAATCTGTAGGAGCTGCCTGGTATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAAGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAAATTCCCaaaaaaaaCTCTGTCCCGCTTTATGATCCGCAAAAATTAAGTATGGCGCCAGATCAGCCCAGGGCCTTAAACCCCCGAGCGGGAAACATCATGGGCAGTTCTTTTTTGTCAGGAAAAAACCTCTGGCACCTGAACAGCATTCACTGGTCTAAAGGAGGGTGGTTTTATCAATTGGGGAAACCCAATCACCTGGTGTTCTGTGTCAATGGGGACCCCAACAAAATTCCGAAACAAAAACAGGGGaaaaaaaaaaaTTTCGGCCCTTTCCAGGGGAAAACCAAGGTGAAAGCTAATGGGGGGGTCCCGGGGTATTTCCCAACCCGACCTTATTTTCATTTCAAAGAAC
  5   1   2       bld Brn1 5g                         IMAGE:6955650.5p                                                                               TAATCTGTAGGAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAAAGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCCAACAAACAGTGAAGAAAATATCTGCTTCAGTGGGACAAGG
  5   1   2       add Brn1 5g                         IMAGE:6954618.5p                                                                                  ATTCTCGAAAAATGCGCTGGATCAAGCAGAGTAACCTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGTTCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAAGCATTTTCTACCAACCATTTAGAAGATAGAATTCACAAAAAGAACCTCTGTCCCCCCTTATGATCCGCCAAATTCAGCTATGCCCCCAGAATCACCCAGGGGCCCTAAACCCCCGAAGCGGAAAACATCCATGGCCACTTTCTTTTATGGTTCAGACAAATCCTCCTGCCACCTGGAACAAGCAATCACCTGTTTTTAAAGGAGGGCTGTTTTCTTATTCATTGGGGGGAAACCAGATTCCACCTGTTGTTCCCGGTCAAGTTGCTGGAACCAAACCCACAATCCCCCTAACACTAAAAACATGCTGGTAAAATCACAAAATAATTCCCTGCGCTTCTCCAGCTGGGGGAAAAACAAAGGCTTGGGAGA
  5   1   2       bld Brn1 5g                         IMAGE:6954970.5p                                                                                         GAGCTGCCTGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAAACAAATCACTGTGTCTGTCAGTGTGACCAACAAAATCCGACAAAACAGTGAAAGAAAT
  5   1   2       add Brn1 5g                         IMAGE:6952968.5p                                                                                                 TGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCCTAAAGGAGGTGTTTTTATCATGGGGCAACCAAATCACTGTTGTCTGTCAATTGTGGACCAAACAAATCCCCAAAAAACAGTGGAAGAAAAATATCCTGGCCTTCAGTTGGGAACAAGTGGAGTAAATGTGGGTCCCTGTTATTCCCAGCCGACTAATTACC
  5   1   0       chi Brn1                            IMAGE:6953491.5p                                                                                                 TGGCATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAACGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAAGAGAGGCTGATGAATAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCATCAGCCAGCTCCCTCAGATGTGGGCAAAGCCTGTGGCGTGGATTTTGAAAATAAGGGATTTTCTACAACCAATTTAAAAAATATAATTCACAAAAAGAACCCCTGTCCCCCCTTTATGCTCCGCCAAATTCACATACTGCCCCATAATCAACCCAGGGGCCTTTAACCCCCCGAGGCGGTAAGACCATCTCTGGGGCAGTTCCCCTTTTATGGCTGCGGAACTAAAACCCTCCCTTGCCACTCTTGTATACAGCCTATTCCACGTTGTACGTTTAACGGACACGATGTGTTATACTTACACCCCCTggggggggTAAAAATTAAAATTTTTCTTTGGGGGTGGTCTCTTGCTGCCCCCTGTGTTTTAAACCCACATAACATATCGTCCGCTCATTACATAATTCCCGCCTTGTCAACCTAAAATAATTATCATTCGCCCTTCCCAAGGTGGTACATCACCCCACTCTGGGAGGTTAGAATGCGTACGGTCCCCCCAGGGATATTTTCCCCCGGACAGAATTCTTTTGTTCTCCTACCCCCAAGACACAGGGAGGGGGGTCCAACATGGCCAAAAGAAATGCGCATAAGCCCTCCGACAACAGCGGTGCGACTCTTCACCCTGAAAGCCGCTTCTTCACTTAAGATAAATCCTAGACCGCTCGTTTTATCCCACCACACGATGATACCATTCTAAAACCTTGCGGACCTTTATAAAGAA
  5   1   2       bld Brn1 5g                         IMAGE:6955754.5p                                                                                                     ATCAAGCAGAGCAAAACTAGACCATTGCTCACTGTGCTAAAGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGGTCTAAGGAGGTGTTTTATCATGGGGGAACCAATCACTGTTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAA
  5   1   2       bld Brn1 5g                         IMAGE:6955412.5p                                                                                                           CAGAGCAAAACTAGACCATTGCTCACTGTGCTAAAGGGTTACCTTACTGGATCTCAGGAATTCACCTCTTTCTTCAGCAGGTGTTCAGCAGTCAGTGATCTGCACATTCCATTATGAGTGGTGAAAAGAAATCCAGACATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGNGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAAGAAAAAATCTGCTTTCAGTGGAAACAAGTTGAGTAATTGTGGGTCCTGGTATTCCCAGCGAACATATTA
  5   1   2       add Brn1      in                    IMAGE:4740461.5p                                                                                                                                                                                                                              GAGTGGTGAAAAGATTTTCATTCATGTCATGTATAAGAAAACCTCCCGGGATAAGGCGGTGAGCGTGTACCTGGGCACAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTCGGATCC
  5   1   2       bld Brn1      in                    IMAGE:6956555.5p                                                                                                                                                                                                                                                                                              TGTACCNTGGGCAAAAGGGATTATGTTGATCATGTGGATTCTGTGGAACCAGTAGATGGAGTTGTTCTGGTGGATCCTGACCTCCTTAAAGGAAAAAAAGTGTACGTCACTCTTACCTGCGCTTTCCGTTATGGTCAAGAGGATATTGATGTCATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCTTTGGGAGAGTCTAACGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACCATCGGGAAGAGAAGAGAAATTGCACTCGATGGGGAAACTCAAACATGAGGACACCAACCCTGGGCTTCAGCACTCTGGCTAAGGAAAGGCACTGGACCGCACCGTTCAGG
  5   1   2       bld Brn1                            IMAGE:7019114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTGGCCTAACCTTCCGTAAAGACCTTTACTATGCTCGGACTCAGATTTACCCACCAGTAGAGGACCCCAAAGCCTTGACCAAAGTTCAGGAGAGGCTGATGAAGAAATTAGGGAACAATGCATTCCCATTTGTGCTGGAGTTCCCTGATTTCTTGCCATGCTCAGTGTCTCTTCAGCCAGCTCCCTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGGAGCTTCCATTTATTCTCATGCATCCCAACCCCGAACGGCGGAA
  5   1   2       bld Brn1                            IMAGE:7018497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCAGATGTGGGCAAGGCCTGTGGTGTGGATTTTGAAATTAAGGCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCTTTGGAAGAGTCTAACGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCANACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAAGCACTGACCGCACCGTCATGGGAAATCTGGTGGACTACAAGATCAAAGTGACCCCTCAACGGTTTCTGGGGCTGCTGGGGAGACATGACCCTCAAGTGAGGGTCTCCACCGGAGCCTTCCATTTAATTCTTCATGGCATCCCAAAACCCCAGAACGGGCGGGAACCCAAAAGAAAAGGTTGGGCCAAggaaaaaatgaaaatttgttgggttttggaaaaaaattttC
  5   1   2       bld Brn1      in                    IMAGE:6956436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATTTTCTACAAACAATTTAGAAGATAGAATTCACAAAAAGAACTCTGTCCGCCTTATGATCCGCAAAATTCAGTATGCGCCAGATCAGCCAGGGCCTAAACCCCGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGNGAGAATCTGGTTAGCCAGTATCCATACCCCTGTAGCAAAGTCTATAGCAAAGGGCATTTTATTACATTTGAATCTAGttttttttttATG
  5   1   2       bld Brn1      out                   IMAGE:6950410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTACCGGGTCCNGGAATTCCCTGGGATCGCAAAATTCAGTATGCACCTGATCAAACAGGGCCTACACCTCGAGCGGAGACATCTTGGCAGTTCTTTACGTCAGACAAACCTCTGCAGCTGACAGCCTCTCTGCCTAAGGAGGTGTTTTATCATGGGGAGCCAATCTCTGTGTCTGTCAGTGTGACCAACAACTCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTAAGTAATGTGGTCCTGTATTCCAGCGACTATTACGTCAAGACGGTGGCTTTGGAGGGGTCTGAGGACAAGGTGCCTTCAAAGGCGTCGTATAATCACACCTTTACCTTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTAGATGGGAAACTTAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCATTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTACTGGGAGACATGACCTCAAGTGAGGTCTCTACGGAACTCCCATTCATTCTCATGCATCCAAACCCAGAGAGCGGAGCCAAAGAAAGTGAGCAGGACGATGACATGGTGTTTGAAGAATTTGCACGTGATCCACTTAAGGGTGAACTGCAAGCTGAAGAAAAAGAGGAAGAGGAGGACGATGAGAAATAAGACATGAAATTAGCCAGTATCCATACCCTGTAGTAAAGTCGATAGCAAAGAGCATTTATTACATTGATCTAGTTCCTCCTATGTCATCCCTGTGCCAAATTGGTCCTTGACCTGATTAATACAGAAAGCAGGGTAATACCCATGGTTAACAAAGGTAAGGTTCAAAAAGTACCCCTTT
  5   1   2      seed Brn1                            IMAGE:6955864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGCGGAGACATCATGGCAGTTCTTTATGTCAGACAAACCTCTGCACCTGACAGCATCACTGTCTAAGGAGGTGTTTTATCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGttttttttATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGGAACAGGAGCAAGTAGGGGTCAGTTTTCCATGGGTTAATACAGAAGAG
  5   1   2       bld Te2                             IMAGE:7393281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACCCACGGAGCTCGTGTATGTTTATTATATAAATAATAAACTTGGATTATTCCTTTTACCTCGGTGATCTCCGGTCTTTGGATTATTCCCTATCATTACCTTTTATCAACACGTATCAGACTTTGAAATAGTGTCAGCGTAATGTTCTGTTCTTATGGAATGGGCATGTTCAGGTAATAGAAACTGTTAGCAGGTTTTTCATGTTCAGACCCATTCTTGTTTCCTCAGCGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACGGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTNCAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCCATACCTGTAGCAAAGTCTATAGCAAGGGCATTTTATACATGATCTAGTTTTTTTATGCCTTNATGCNTAAATTCCNTGACTGAGCACTAAGATAAGCTCCTATGTGAACATAA
  5   1   2       bld Brn1                            IMAGE:7019192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACAGCATCACTGTCTAAGGAGGTGTTTTATNCATGGGGAACCAATCACTGTGTCTGTCAGTGTGACCAACAAATTCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGttttttttATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAACAGTAGGTGTCAGTNTTTCCATGGTTAATAACAGAAGAGGGGGACACAGGATAATTACCTCTTGTTAAACAGAAAC
  5   1   2       bld Brn1                            IMAGE:7019461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGTGTCTGTCAGTGTGACCAACAAATCCGACAAAACAGTGAAGAAAATATCTGCTTCAGTGGAACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGttttttttATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGGTTACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGGATTCCGCCTGCATTTGGA
  5   1   2       bld Brn1      in                    IMAGE:4740948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAAGTGAGTAATGTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGC
  5   1   2       bld Brn1                            IMAGE:7018740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGGTCCTGTATTCCAGCGACTATTACATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGttttttttATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGTGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGGATTCCGCTGCATTTGATACACTATACAGAAATGGCTGAATAAGGTAGAACAGGGCATGGTCTGGGAATCACCCTCTTT
  5   1   2       bld Brn1      in                    IMAGE:6951405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTCCGGAATTCCTGGGATCAAGACGGTGGCCTTGGAAGAGTCTAATGAAAAGGTACCTTCAAAGGCTTCGTATAATCACACCTTTTCCCTGCTGCCTCTGCTGGCATACAATCGGGAGAAGAGAGAAATTGCACTCGATGGGAAACTCAAACATGAGGACACCAACCTGGCTTCCAGCACTCTGCTTAAGGAAGGCACTGACCGCACCGTCATGGGAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTNCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATTAGCAAAGGGGCATTTATTACATTGATCTAAGttttttttAAGCCCCCTTAAGGCTAAAAAATTCCCTGTGGCTTGGGCCCCCTaaaaaaaaaaaGGCTCCTCCTTTTGTGAAAAACCTTTTAAAATTTTTCCTCGGGGaaaaaacaaaaaacccttggggggggccctttttttccggggggggtnaacccccaatgaagggggggcgccccccaaaaaaaacccccccctgttttaaaaaaaaaaaaaaaaattttttcccagagaacccccccttttttataagagagaaaaacaaaacaacctccccctcggggggggaaaacccccccccctcttttttttttttccccccccaccacaccaagagagagggggggg
  3   1   2       chi Brn1      in                    IMAGE:6951405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTGCCAGCACCCTTTTGGCTTTAAAGGGAAAGGGCAATTGGACCCGACCCCGGTTCCATGGGGAATTCCTTGGGTGGGATTACCAAGGATTCAAAAGTGACCCCTCCACTGTTTTCTGGGGTTGCTGGGGAGAACATGACTTCAAAGTGAGGTCTTCCAGGGAGCTTCCATTTAATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTCACTCTTTTTGGAA
  3   1   2       add Brn1      in                    IMAGE:6956555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGGGACACCCAACCTGGCTTCCCAGCACTTTGNTTTAAGAAAGGGCACTGACCGGCACCGTCATGGGAATCCTGGGTGACTACAAAGATCAAAGTGACCCTCACGTTTTCTGGGCTGCTGGGAGACATGACCTCNAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAACCCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGGTAATAACTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTAATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTCCCTCCTTATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTATTACTACAGTCAGAAACAAATGAGTTGTACACGGATGAGT
  3   1   2       bld Brn1                            IMAGE:6950798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACATGGAGGACACCAACCTGGCTTTCCAGCATTCTGTTAAAGGAAGGCACTGACCGCAACCGTCATGGGAATCTTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAAGT
  3   1   2       add Brn1                            IMAGE:6950750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACCTTGGCTTCCAGCATTTTGCTAAAGGAAAGGCACTGACCGGCACGTCATGGGAATCCTGGGTGGACTACAAGATCAAAAGTGACCCTCACGTTTTCTGGGCTGCTGGGAGACATGACTCAAAGTGAGGTCTCCACGGAGCTTCCATTATTCCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGGTAATAACTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTAATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTCCCTCCTTATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTAGTACTACAGTCAGAAACAAAGT
  3   1   2       bld Brn1 5g3  in                    IMAGE:6951442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGGACACCAACCTGCTTTCCAGCACTCTGTTAAGGAAAGGCACTGACCGCACGTCATGGGAAATCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACTCNAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTNTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGGTGTA
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTCCCAGCATTCTGNTTTAAGGAAGGGCACTGACCGCACCCGTCAATGGGAATCCTGGTGGACTACAAGATCAAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGTGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTATTAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGAATAACCCAAATAAG
  3   1   2       bld Brn1      in                    IMAGE:6956436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCAGCACTTCTGCTTTAAGNGAAGGCACTGACCCGCACCGTCATGGGAATTCCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAG
  3   1   2       bld Brn1                            IMAGE:6950751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAAGGAAGGCACTGACCGCACCGTCATTGGGAATCTGGTGGACTACAAGATCAAAGTGACCCTCACGGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGGTAATAACTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTAATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTCCCTCCTTATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTTGTACACCGATGAGA
  3   1   2       add Brn1                            IMAGE:6956796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATGGGAATCCTGGGTGGACTACAAGATCAANAGTGACCCTCACGTTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAAGATGACATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCAGAAGAAAAAGAGGAAGAGGAGGATGATGAGAAATAAGACACAACATTCACCATCTCTGGGGAGAATCTGGAATCTGGTTAGCCAGTATCCATACCCTGTAGCAAAGTCTATAGCAAAGGGCATTTATTACATTGATCTAGTTTTTTTATGCCCTTTATGCTAAAAATTTCCTTGACATGAGCACATAAAGAATAAAGCTCCTTATGTAGAAACATTAGAACTTCTACTGAGAAACAAGAGCAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGGTAATAACTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTAATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTCCCTCCTTATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGGAACAAATGAGTTGTAACACTGATGTTGTGAAACAAATAAG
  5   1   2       bld Brn1      in                    IMAGE:4740400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGGTGGACTACAAGATCAAAGTGACCCTCACTGTTTCTGGGCTGCTGGGAGACATGACCTCAAGTGAGGTCTCCACGGAGCTTCCATTTATTCTCATGCATCCAAACCCAGACGGCGGAGCCAAAGAAAGTGAGCAAGAATATTTCATGGTGTTTGAAGAATTTGCCCGTGATCCACTCAAGGGTGAACTGCAAGCA
  3   1   2       bld Brn1                            IMAGE:4740636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAACAAGAGCAGTAGGTGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGGTTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTATTAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGACGGCAGTATGACTCCAAAAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4740400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTAGGGGTCAGTTTTCCATGGTTAATACAGAAGAGGGGACACAGATAATACCTCTGTTAACAGAAGTAGATTCCGAGTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTGATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTCTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGACGGCAGTATGACTCCAAAAAAAAAAA
  3   1   2       bld Brn1                            IMAGE:4740745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTACCCATTTAAATGAATACATACATCTCTGGGATTCCGCTGCATTTAATACACTATACAGAATGGCTGATAAGTAGAACAGGCATGTCTGGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATCTTCATTTACTAACAAAACAAGTCCCTCCTTATGTGATTGTGACCCACTTGAGATTGTACGGTTCTGATCAGTATTAGCATGGACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTTGTAACACTGATGATGTAACCCAAATAAAGCAGACGGCAGTATGACTCCAAAAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4740948.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAATCACCTCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATTTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTTTGATCAGTATTAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTACAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGCCGGCAGTATGCCTCCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn1      in                    IMAGE:4740461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTTACGTGGTTCTCACTGATTGGTTGGTTGTGTAAAGCAAGAGATGCAAAAGAAAGAAAATGGATTTTCATTTACTAACAAAACAAGTTGTTCCTTATGTCCACTTGAGATTGTACGATTTTGATCAGTAATAGCATGAACTGTTTGTATTTAATGCATTCCTACTGTATGTACTCCAGTCAGAAACAAATGAGTGGTAACACTGATGATGTAACCCAAATAAAGCAGCCGGCAGTATGCCTCCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)