Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 81%

 1012772724 Xl3.1-IMAGE:6318063.5 - 25 ESTs
                                                                       .........-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6318063.5                                                                                                                                                      GACCCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTGCTGAGGGAGGAAGAATTCTCGCCACTAAAGAACGCGGATACGGCCGATAAGGACACCCCAACAACAGCGAGGCGGGCGCTTCTGTGGCAACATTACCGCTGGGCAAAGAGATCCGGCGCCCGCTTTTTAGATGAGAACGGCAGCCCCATACCTGACAGCTACAGGATTTCAAGCGAGGGCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCCTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGGCACTTACAGTTGTACTTAC
                                                  Xl3.1-CHK-1012688775                                                                                                                                                            ACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTGCTGAGGGAGGAAGAATTCTCGCCACTAAAGAACGCGGATACGGCCGATAAGGACACCCCAACAACAGCGAGGCGGGCGCTTCTGTGGCAACATTACCGCTGGGCAAAGAGATCCGGCGCCCGCTTTTTAGATGAGAACGGCAGCCCCATACCCGACAGCTACAGGATTTCAAGCGAGxxCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCCTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGGCACTTACAGTTGTACTTACTGTCTG
                                                      consensus depths                                                                                                                                                           4     4     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    11    10    10    10    10    10    11     9    11     9    11     9    12     9    12     8    12     8    12     7    11     7    11     7    11     6    10     6    10     6    10     6    10     7    11     7    11     7    10     7    10     7     9     8     9     8     8     8     8     7     7     7     7     7     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     5     8     4     7     4     7     4     7     5     8     5     8     4     7     4     7     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     4     6     4     6     4     7     5     7     4     7     5     7     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     8     9     8     9     8     9     8     9     8     9     7     9     9    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     7     6     7     6     7     3     7     3     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----CG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                               BLH ATG      -3     257                                                                                                                                                      
  5   1   2       bld FaBN 5g                         IMAGE:8078377.5p CAGGAACTGTGTCACATGACTGAGCGGCAAACTCCGCTTTATAGGTAACAAGGGGAGGGGAAACTCCGCCTCCGTCACGCGCCAATCCCCGCCCTCAGCCTATTAGCGGCGGCGCTTCCCGGCTGGTCTCCATAGTAACGGGAGATATGGACCCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGGAGAGGTCGACGTGATCATGTTT
  5   1   2       bld Emb1 5g                         IMAGE:6863787.5p                                                                                                                                          CCACGCGTCCGGGAGCCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTAGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGATGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGGTCTGTACCGGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAAGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGGACACATCCTGGTCAAGATGGCCGACCCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGGTAATGGAAAAA
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074915.5p                                                                                                                                             GGAGATATGGACCCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGNAGGACATGGAAGGGAGGGGCATC
  5   1   2       bld Kid  5g                         IMAGE:4032335.5p                                                                                                                                                   ATGGAGCCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGATTCCGGACAGTGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGCGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGNGGAACGGNGGTCTGTACCNGGGCTTTGTCTGATAACCGCATCCTGGAAGACATGGAANNGGAGGGGCATCCAGTACATTCACNGTCTATTGGTGTGGACAACATNCCTGGGTCAAGATGGNCCGACCCCCGTGNTTATTTGGGCTTCTGGGTGTCAGCAAAGGGG
  5   1   2       bld Em10                            IMAGE:8320817.5p                                                                                                                                                         CCTACGGGAAGCGTCGAGAGTCGGAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAGGCCATTCTGGAGGAAAAGCTAACTTGCTTGGCTCAGATGGGACGGGGTCTGTCCCGGCTCGTCTGATACGCATCTGGAGACTGGAGGAGGGCATCATACTCCGTCATGGTGACACTCTGTCAATGCGACCGTGTATGCTCGTTCACAGGCATTGGCNAGATGAAGGTACACACATGGTGTT
  5   1   2       bld Neu7      in                         XL010l03.5p                                                                                                                                                                                GAGACAACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCA
  5   1   2      seed Em10                            IMAGE:8322172.5p                                                                                                                                                                                            GGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTTTGGGATGAGCTGAGCCCGGTGGAAAAGGAGGCGCTGCTGGATCAGCTGGAAATGCTTGAGCCCCGGGAGTTGAAGGAGCACTGTCTGCGGGCGCAGGAAGCGTATGTGCGGGACATCAGCGCCCCCCAGCGGCTGGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGC
  5   1   2       bld Ov1                    IMAGE:6318063-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                    GGATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGT
  5   1   2       bld Ov1                             IMAGE:6318063.5p                                                                                                                                                                                                                                                                                                                                                                      ATGATACAATGCAGCCTGTACCCTCACTGTTACTGGGCAGCGTCCGGCACAGCAGCACCGGGGAGCTGGACTCATGGGAGAGACAGGGGTTTCATCAGATTGCGCAGAACAAGGTGGCCGTCCTTCTTCTTGCTGGGGGTCAGGGAACCCGTCTGGGGGTGACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAgggggggtggggTGTCAAGGAGACGGCGTTTATCAGGTGGGGGAATACAGCGAAATAACCCCCGAAACTGTGGAGAAACGCAATCCCGGATGGGAGCCTGACCTTCAGCGCTGGGAAAATTCTGGAAATCCCTTCCTTCACTGGGGCCCTTTCCTCAGGGCTGGCCACTGGGGCCCGTTGGGAGCCGCGCCCTTAAATTACCCCCGGTAGCCCATTAGGAAAAATCCCCTTAACGGTGGAACCAGTGGGGCGAAAAATTTGGtggaaaagccgaagccgcaaccaaaccggggaaatcaaaaagggggaaaaaaGTTTGTGTGTTATCCACACGCCTTTTCCGCAGGTTTGTGAAAAAGAAACC
  5   1   2       bld Bone      in                    IMAGE:8740816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGTACCCCAAAGGAATGTACAGAGTGGGCCTGCCGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTTGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCCGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACATGAGGGAAATTTGGTGAAACGACGCGACAACGGGATCAAATGGAGAGTTTGTGTTCGACGTCTCAGTTTGCAGACTTGTGCTTTGAGGTGCTGAGAGAGATCTCGCCACTTAGACGCGAATCCGCGATAGGACCCCCCACAAACAGCGAGGCGGGGGCATCG
  5   1   2       bld Tail      in                    IMAGE:8542580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGTGCTAAAACCCTGTACCAGATCCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCAGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAG
  5   1   2       bld Te2                             IMAGE:7393611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGGCAGAGCGGATCCTCCGGGTGCAGCATTTGGCCAGTGAGCAACATGGCGTCTCCTGCATCGTGCCTTGGTACATCATGACGAGCGAGTTCACTCTGGGTCCCACACGCAAGTTCTTCGAGGAACACGACTACTTTGGGCTGGAGAGGTCGGACGTGATCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGATTTGATGGAAAGGCCATTCTGGAGGATAAAGCTAAACTTGCTATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCAGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAATCCCTTACGTGGACAATGAGGGAAATTTGGTAAACCGACGCGACCAACGGGATCAAATGGAGAGTTGTGTTCACGTCTCCGTTGCAAGAACTTGTGCCTTGAGTCTGAGGAG
  5   1   2       bld Neu7      in                         XL041p15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCAGACTGTGGGGCCAAGGTGGGTGTCACGTGTGGGGTGATTGTATTGAAGGGAAGACACCTGTCCTGATCAATGTGACCCCTTCATGCAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCC
  5   1   2       bld Tbd7      in                         XL107m13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTGCTATGGCTCCAGNATGGGAACGGGGGTCTGTACCGGGCTCTGTCTGATAACCGCATCCTGGAGGACATGGAAGGGAGGGGCATCCAGTACATTCACGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCAGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCAGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTT
  5   1   2       bld FaBN      in                    IMAGE:8074519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCCGACCCCGTGTTTATTGGCTTCTGTGTCAGCAAAGGGGCCGACTGTGGGGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGTCAAGTAGACGGCGTTTATCAGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAACGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTGCTGAGGGAGGAAGAATTCTCGCCACTAAAGAACGCGGATACGGCCGATAAGGACACCCCAACAACAGCGAGGCGGGCGCTTCTGTGGCAACATTACCGCTGGGCAAAGAGATCCGGCGCCCGCTTTTTAGATGAGAACGGCAGTCCCATACCTGACAGCTACAGGATTTCAAGCGAGTTCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCGTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCNGGGCAGTACCAGTCTGAACCAGCGGCTACTACAGATGCCAATAGGGGAGCAATTGCTGTGACTGACAATCTCGCTTCTCCCATTA
  5   1   2       bld Gas9                                 BG409471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCGCGTCCGGTGGTGGAATACAGCGAAATAAGCCCCGAAACTGTGGAGAAATGCAATCCTGATGGCAGCCTGACCTTCAGCGCTGGAAACATCTGCAATCACTTCTTCACTGTGCCCTTCCTCAGGGCTGTCACTGGGTCGTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAATCCCTTACGTGGACAATGAGGGAAATTTGGTGAAACCGACGCGACCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTGCTGAGGGAGGAAGAATTCTCGCCACTAAAGAACGCGGATACGGCCGATAAGGACACCCCAACAACAGCGAGGCGGGCGCTTCTGTGGCAACATTACCGCTGGGCAAAGAGATCCGGCGCCCGCTTTTTAGATGAGAACGGCAGCCCCATACCCGACAGCTACAGGATTTNAAGCGAGGGCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCCTATTTCGGAGAGGGGTTAGACTCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGCCAGTACCAGTCTGACCCAGCGGTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTTTCCCAATTACATTGTAANGCANGGCTTGTTCAACTGGGGCN
  3   1   2       bld Neu7      in                         XL010l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTGCTGAGGGAGGAAGAATTCTCGCCACTAAAGAACGCGGATACGGCCGATAAGGACACCCCAACAACAGCGAGGCGGGCGCTTCTGTGGCAACATTACCGCTGGGCAAAGAGATCCGGCGCCCGCTTTTTAGATGAGAACGGCAGCCCCATACCCGACATCTACAGGATTTCAAGCGAGGGCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCCTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTNCTGTGGCATTTTCTAA
  3   1   2       bld Bone      in                    IMAGE:8740816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGGGTCGCGCGGAATACGGGCCGATAAGGGAACACCCCCAACAAACAGGGGAGGCGGGCGCTCTGTGGCCACATAACGCTGGGCAAAGAGGATCGGCGCCGCTTTTAGATGAGAACGGCAGTCCCATACTGACAGCTACAGGATTTCAAGCGAGTTCGACCCTCCAGCTGTGTGTGAGATCTCCCGTTTGGTGTCTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCTCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAACGCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTATAAGGACTACAGCGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATCCCAGAAGCTGCCCCTGCCCAGGTGGCCAACCTAAGTGCCACCTGGCATGGCAGCTTCTGCATA
  3   1   2       bld FaBN      in                    IMAGE:8074519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCCGCTTTTTAGATGAGAACGGCAGTCCCATACCTGACAGCTACAGGATTTCAAGCGAGTTCGACCTTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCGTATTTCGGAGAGGGGTTAGAATCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAACGCCCTGCTCCAGATTCTGCTGCCGCCGCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTATAAGGACTACAGCGTATGAATGGCAGCCAGCTACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTGATTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGCACAGTTGTACTACGTCGANNGCTTATACTTCTTTTTTT
  3   1   2       bld Tail      in                    IMAGE:8542580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACACATAGCTGTGGCTGGATTCCGAGTCCTGTTTAGTGACGCAGTACATCCTGACGTTCAGATTCAAGCAGGGCGACTCAAGCTGTGTGTGAATCTTCCTTTGGTTCGTATCGGAGAGGGTTTAGAATCATACGTGAGACAAGAACATTTCCTTTGAGCTTTTATTGTGGAGAGAAGTGACTCGTCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCATTAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCTCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCGTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGCGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAACGCCCTGCTCCAGATTCTGCTGCCGCCGCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTATAAGGACTACAGCGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGGCACTTACAGTTGTACTTAGGGTGCTATATGCAAAAAAAAAAGGTAGGA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATACCCGACATCTACAGGATTTCAAGCGAGGGCGACCCTCCAGCTGTGTGTGAGATCTCCCCTTTGGTGTCCTATTTCGGAGAGGGGTTAGACTCATACGTGAAGGACAAAGACATCTCCTCTGAGCCTTTTATTGTGGAGAGAAGTGACTCCGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCCTCCAATCCCAGAAGCTGCCCCTGCCCAGGAGCACAACCGAAGGCCACCGGCANNGGCATTGTACTAATTTTAAGGG
  3   1   2       bld Tbd7      in                         XL107m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAA
  3   1   2       bld Neu7      in                         XL041p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAGTACCAGTCTGACCCAGCGGCTACTACAGATGCCAATAGGGAAGCCATTGCTGTGACTGACAATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACCTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGGGCACTTACAGTTGAACTTACTGTCTGTATGCAATAAA
  5   1   2       bld Ga12      in                         XL167b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTAtttttagttttttttATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGGCACTTACAGTTGTACTTACTGTCTGTATTGCAATAAATAGCTCTGGGACTCCCaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL167b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATCTCCGCTTCTCCCCAATTACATTGTAAGGCAGGGCTGTTCAACTGGGGCCTGTAGGCAGGATGTGGCCCCTGAAGATGCTGCGTATGGGCCCTGTTGGAAGCAAAACCCCCTCTCTCTTCTTGTAGCCAAAGATTAAAGCCACTCTGCACTTTTAGCCAAATGTGGGACTGACTTGCCACTGGGCATGGGATTTAATGAGGCCCCCCTGCACTGCCACTTCTGATTGGGTGTTGTCACTGCCAACTCTGTGGCATTTTCTAATGTCTGATGTTTTCTCTTTTTAATAAATTCCCTGCTCCAGATTCTGCTGCCGCCTCCATCCTCTTCCTCATTGATCTCTATAGTGCCAGCCAGTTCCACTGTACTGTGTAAGGACTACAGTGTATGAATGGCAGCCAGCGACCCTGCCCACAAGCAATATGGCAGCTCCCAGCCCAGATGTTATATCAACAAAGTGACTATTTTTAGTTTTTTTTATAAATCATTCAATGCCAGAAGCTGCCCATGCCCAGGTGGCACTTACAGTTGTACTTACTGTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)