Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL200e22.3                           12 END     4          30       33                (no blast hit)

 This cluster: approximate FL confidence score = 81%

 1012772771 Xl3.1-xl241k06.5 - 13 ESTs
                                                                       ..-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl241k06.5                                                                                                                                                         CAAAGATTTCATAGGTCCAACAGCAGCTACGAAGATTTCACGACTTCGTTTTGCAGAGCCATATTACTGGAACAATTAATCTGCTTGATTCAAGCCATAACCGAGCATAGTTCTGGCAATGATGTAGAGGTATAGATGGGTTAAGCGCTCCTCTCTGTCCACGTGGCTAAAGAGGTTTTTCTCATGTGTTCAGTTTTCTCGAGGACATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAGGACAGCATAGATTTGTAGGGTTATAAACGCAGGTCCC
                                                  Xl3.1-CHK-1012692733                                                                                                                                                               TTTCATAGGTCCAACAGCAGCTACGAAGATTTCACGACTTCGTTTTGCAGAGCCATATTACTGGAACAATTAATCTGCTTGATTCAAGCCATAACCGAGCATAGTTCTGGCAATGATGTAGAGGTATAGATGGGTTAAGCGCTCCTCTCTGTCCACGTGGCTAAAGAGGTTTTTCTCATGTGTTCAGTTTTCTCGAGGACATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAGGACAGCATAGATTTGTAGGGTTATAAACGCA
                                                      consensus depths                                                                                                                                                              3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     7     8     7     8     7     8     8     9    11    11    11    11    11    11    11    11    12    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     7     8     6     8     6     8     6     8     6     7     6     7     6     6     6     6     6     6     6     6     3     4     3     3     2     2
                                               EST CLI     400      13                                                                                                                                                         
                                               ORF LNG     369       8                                                                                                                                                         
  5   1   2       bld Neu7 5g                              XL037h03.5p TATAtttttttttCTGAATTAATGCATTTTTTGCTTCAGTCCTTGTTTCATGTGTAGCCAGCTTTTATGAAGAGNATGCAAACTGATATCAATTGTCTGACAGACAACAAAAAAAGAGGAGGAAGTGTTAAGAAAACGAATGAAAAGCACACAAAGNATTTCATAGGTCCAACAGCAGCTACGAAGATTTCACGACTTCGTTTTGCAGAGCCATATTACTGGAACAATTAATCTGCTTGATTCAAGCCATAACCGAGCATAGTTCTGGCAATGATGTAGAGGTATAGATGGGTTAAGCGCTCCTCTCTGTCCACGTGGCTAAAGAGGTTTTTCTCATGTGTTCAGTTTTCTCGAGGACATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTG
  5   1   2       bld Spl  5x                         IMAGE:8462136.5p                                                         GTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGTGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATTGCTGGAACAATTAATCAGCTTGATTCAAGCCATATCTGAGCATAGTTCTGATGTAGAGGTATTGGTTTAAGTGCTCCTTTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGTGCTTCAGCTTTCTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCCCTGCATGTACCTTGAACTTCTATTTTGAGGAGCGCATCTTCAGAATATGCTCTCCTCCTTTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTACACCATGCTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTATATGCGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCttttttttttttCACATAAGTGCCAAAGAGGAAGTTGATTTACATACAAACAGGAAGAGGATGGGCAGCCAACACCATTCCAGCAGTCGCAGAACACTGATGCCAGACAATACTACTGCTCAGCTAGTGTGTTAATGCTGGGATTGTGGNTTCTGTGCAGTTGGCATGCTAAAGGCACCTATCCCTGAGGCTAGACATCT
  5   1   2       bld Tbd7 5g3  out                        XL056a24.5p                                                                 CTTTTATGAAGAGATGCAAACTGATATNATTGTCTGACAGACAACAAAAAAAGAGGAGGAAGTGTTAAGAAAACGAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTACGAAGATTTCACGACTTCGTTTTGCAGAGCCATATTACTGGAACAATTAATCTGCTTGATTCAAGCCATAACCGAGCATAGTTCTGGCAATGATGTAGAGGTATAGATGGGTTAAGCGCTCCTCTCTGTCCACGTGGCTAAAGAGGTTTTTCTCATGTGTTCAGTTTTCTCGAGGACATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTNGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAG
  5   1   2       bld Egg1 5g                            PBX0124A05.5p                                                                                                                                        CACGAGGGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTACGAAGATTTCACGACTTCGTTTTGCAGAGCCATATTACTGGAACAATTAATCTGCTTGATTCAAGCCATAACCGAGCATAGTTCTGGCAATGATGTAGAGGTATAGATGGGTTAAGCGCTCCTCTCTGTCCACGTGGCTAAAGAGGTTTTTCTCATGTGTTCAGTTTTCTCGAGGACATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACT
  5   1   2       bld Tbd7 5g3  out                        XL071h22.5p                                                                                                                                                                                                                                                                                                                                                                       ATGAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTGAACTTCTATTTTGAGGAAAGCATCTTCAGATTATACTCTCCTCCTTTAACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATGAGCATGGGTGTTAGCATTTCGGA
  5   1   2       bld Thy  5x3                        IMAGE:8547829.5p                                                                                                                                                                                                                                                                                                                                                                                               CTTCTTTTTTCCAGGATAACCTCAAATTCGATTCGTCCAAGCATCTTCAGATTATACTCTCCTCCTTTTACTTGCATTGCAGTGTTTACTGAGCCACACCTAAATGGTTGAGCTGAAGTCCCGTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGATTGTTGACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGACGGCAGATGGCTGATCCCTCATATT
  5   1   2       bld DMZ  5g3  out                        xl265c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCCACCATGGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAA
  5   1   2       bld DMZ  5g3  out                        xl241k06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCACCATGTTAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCNTCATAACAGACTTCAGCTAGTCATAGGA
  5   1   2       bld Ov1                             IMAGE:6317900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCGTCCGGAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGGTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAAGACAGCATAGATTTGTAGGGTTATAAACGCAGGTCCCTTTCTGTTAATAATTTCTGAAAGCCCAGAAATGACCAACGTGTGATTCCATAGAAAGCTGAGGGACTGCATTTATGCACTTACCAAGCGGCCATGTTGTTTGGACCTTGGATGAAGGGTAATATATTGGGACATACCAGACCGAATTAGAGGTTGAATTCCCTTCATCAATTGCCTGGTTCAGGCAATAACCTTTTTTTGGTCCACTTCCCGGTTGGGTTATAGGTATTAAGAATAGAAAGATTGGAACCTCCTGGGCTCTTCACTCTaaaaaaaaTTGGGGGGGTTTTATAAATAACCTTTGCCTTTTAAATTTGAG
  5   1   2       bld Emb4                   IMAGE:5571738-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAGGACAGCATAG
  5   1   2       bld Ov1                    IMAGE:6316694-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAAGTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGCCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAAAGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTCAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCCGCTAGTCATAGGACAGCAATAGATT
  5   1   2      seed Ov1                    IMAGE:6317900-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCTATGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAGGACAGCATAGATTTGTAGGGTTATAAAC
  5   1   2       bld Spl                             IMAGE:8460410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATATATTGTCAGTTGTATGTGTTCTTTTATTTTTCACATAAGTGCCAAAGAGGACGTTGATTTACATACAAACAGGATGGGGATGTGCCAGTGCCATCCCAGCAGTTGCAGAACACTGATGCCAGACATCACCTACTACTGCACAACTAGTGGGACATGCTGGAATTGTGGTTCTGCAGCACCTGGCATGGGTAAGGCTACCTATCCCTCAGCTAGGACAATCTTAAAGCAGTTCATAAAATCTTCAGGGATGAAATGTGCAATGAAAGCTGCAGAGGTTTATTAATCTGACCACTGCAAAAGAATTAATCTCTTAATGAAAAGCACATTTAAAGGGAACTTATAGCTAAAATGCCAGTTGCTTTTTTAACATAGCTTATACGGTTGATGCAAAAAGATCTGACTGGTAAAAAGCAGCTCTTGAAGTAGTTAAGCAATTGGCTGAGCAAACATTTCTACATGAGGCAATTTACCACATATAAGCATGGGTGTTAGCATTTCGGAGAATTGTTGAACATATAGCATTCCTCAGTTTTGCTACTAAATTGGAAAGAAGAACGGCAGATGGCTGATCACTTTATTATTTTTCTTCATAACAGACTTCAGCTAGTCATAGGACAGCATAGATTTGTAGGGTTATAAACGCAGGTCCCTTCTGTTAATATTTCTGAAAGCCAGAATGACAACATGTGTGATTCTAGAAGCTGAAGACTGCATTATGCACTACAGCGGCATGTGTATGGACTTGATGAAGTAATATATGGACATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)