Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL044l07.3                            9 END     6          66       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl252b14.5                           42 PI      93          1      719                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6946240.5.5                    26 PI      78        153      659                RAB3A, member RAS oncogene family [Xenopus laevis]

 This cluster: approximate FL confidence score = 91%

 1012772793 Xl3.1-IMAGE:7981748.5 - 9 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7981748.5                             GAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCAGCTCACAGAGTCTT
                                                  Xl3.1-CHK-1012697291                                   CCTGCAAACACACAGATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCAGCTCACAGAGTCTTCTCCCA
                                                      consensus depths                                  2     3     3     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                               BLH ATG      90     629                             
                                               BLH MIN      51     135                             
                                               BLH MPR       3     135                             
                                               EST CLI     -36       1                             
  5   1   2       bld Neu7      out                        XL031d17.5p ACACACCTCCACTCCACACAGGGNAGNAGNACACCTGCAAACACACAGNATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCATCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGC
  5   1   2       bld Neu7      out                        XL003e17.5p     GCACACCTCACTCCACACAGGGNAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCCGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGT
  5   1   2       bld Emb1                            IMAGE:5155766.5p                           GAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAAAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTATCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCCAGCTCACAGAGTCTTCCCCCAAGGAAAAACAGCAACTTGTTCCTGTTAAAACACCAACATCAGTAAAAATAAACCACCCGGATTCTGATAGACTGCCTCCTGTTAGATGGCTCAGCATGGCCACCCAGTGGAACTTGCTGG
  5   1   2       bld Em10                            IMAGE:7980855.5p                                 CACCTGCAAACACACAGATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAAAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTATCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCGACGTGAAGCAAGTATGTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGAGTGGCACTGCCAGCTCACAGAGTCTTCCCCANGGAAACAGCACTGTTCTGTTAAACACCACTCAGGAAATAACC
  5   1   2       bld Neu7      out                        XL011i14.5p                                      GAAACACACAGNATCCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCCGCTGACCAAAGTTTTGANTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCATGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCC
  5   1   2      seed Em10      out                   IMAGE:7981748.5p                                                    CCGGGACAGGCAGGAGGAACCCGAGCAAGAGACTGCACCCACCCCAGCCCCCCTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAGGAGTGGCACTGCCCAGCTCACAGAGTCTTCCCCCAGGGAAACAGTAACTGCTCCTGTAAAACACCACATCAGTAA
  5   1   2       bld Em10                            IMAGE:8320947.5p                                                                                                   CCCCCTTGCTGCACCCCAACACTTCAAGATGGCATCTGCCAGTGACACTCGCCAGCCCCAGAAAGATGCTGCTGACCAAAGTTTTGACTATATGTTCAAACTCCTCATCATCGGCAACAGCAGCGTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGAATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCAGCTCACAGAGTCTTCTCCCAAGGAAAACGGTAACTGCTCCTGTTAAAA
  5   1   2       bld Emb4      out                   IMAGE:4959908.5p                                                                                                                                                                                                                               GTGGGAAAAACCTCCTTCCTCTTCCGCTACGCAGACGATTCCTTCACATCGGCCTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAAAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTATCGCACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAAGACAACATCAACGTGAAGCAAGTATTTGAACGTCTAGTGGACATAATCTGTGAGAAGATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCAGCTCACAGAGTCTTCCCCCAAGGAAAACAGCAACTGTTCCTGT
  5   1   2       bld Neu7      out                        XL016d21.5p                                                                                                                                                                                                                                                                                                  TGGGGATCGACTTCAAGGTCAAGACGGNGTACAGGAACGAAAAAAGGGTCAAGCTGCAAATTTGGGACACTGCTGGTCAAGAGAGGTATCGNACAATCACAACAGCCTATTACCGTGGCGCCATGGGTTTCCTGCTCATGTATGACATCTCCAACATGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCACAGGTTCTGCTAGTAGGAAACAAATGTGACCTAGAAGATGATCGGGTGATCCCTGCTGAGGATGGGCGAAAACTTGCTGAGGAATTAGGATTTGAGTTTTTTGAGGCCAGCGCCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)