Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 27 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6874250.3                       5 END     3          21       60                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:4084544.3                       4 END     3          21       75                (no blast hit)
     3   2.0    0Xl3.1-xlk162l12ex.3                         4 END     1           7       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:8079234.5                      72 PI      80        551      799                (no blast hit)
     5   0.0    0Xl3.1-xlk152h13ex.5                        44 PI      80        551      799                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012772836 Xl3.1-XL483f05ex.5 - 14 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL483f05ex.5                                        ATGGACTGGGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAAAAGCCCTTTCTCGTGTCCACACTGCAACAGAGCATTCGCAGACAGATCCAACTTAA
                                                  Xl3.1-CHK-1012692140                                              TGGGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAAAAGCCCTTxxxxxxxxCxxxxxxxxAACAGAGCATTCGCAGACAGATCCAACTTAAGAGCCC
                                                      consensus depths                                             2     4     7    10     9    10     9    10     9    11     9    11     9    11     9    11     9    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12     9    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    13    13    13    13    13    13    12    13    13    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    11    12    10    12    10    12    10    11     9    11     8    11     7    11     8    11     8    11     6    11     5    10     6     9     6     9     5     8     5     8     2     8     2     8     2     7     2     6     2     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                               BLH ATG     127     950                                        
                                               BLH MIN      94     115                                        
                                               BLH OVR     127     103                                        
                                               EST CLI      10      41                                        
                                               ORF LNG     127       3                                        
  5   1   2       bld Int2 5x3                        IMAGE:8824325.5p CAATATAGCTTGGCCCGCCGAGACGTAGAGGCGAGATAAAAATTCGTCCCTGAGCGCGCACAAGATGCTATAGGGATCCGCTTGAGGCCGGGGAGGAAACATAAGTAGCTCCTTGTGGGGACCGTTACTTTGCGAGGCTTGGGGTCCCCCTCCCTCACTGAAAATGCCACGCTCTTTTCTGGTCAAGAAACACTTCAACACGACCAAAAAGCCGAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGCTACCCCGTGTCCGTGCTACCCCAGCCTGACATCTACAGCTCGGTGGCCTACAGACCAATCACGGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGTCGGGTCAGCCCCCCTCCACAGTCGGACACGTCGTCTAAAGACCTCAGTGGCTCAGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCACACCAAACTTTCCGACTCGCATGCGATTGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGTCCAGTCTCGGAATCATTTAGCTGCAAGTACTGTGAAAAGGAATATGTGAGCCTGGGCGCTCTGAAGATGCACATCAGACACACACGTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCGTTTTCTAGACCTTGGGCTACTACAAGACACATCCGCACTCACACTGGAGAAAAGCCCTTCTCTTGTCCACACTGCACAGAGCATTCGCAGACGATCCAACTTAGAGCCCACTGCAGACCCAATCTGATGGTGAAGAAAATATCATGCAAGAACTGTTCCAAACCTCTCTCGAATGTGCGCTGCT
  5   1   2       bld Tad2 5g3  out                   IMAGE:6874250.5p                ACTGCCACTTGCGCTCAGCGGTGAATGGACTGGGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTTCCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATGGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAGCTTTCCGACTCGCATGCGATAGAGGCTGAGAAATTCCAGTGCAGCTTATGCAGCAAGACGTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGGGATCATTTAACTGCAAGTACTGGTGAAAAGGAGTATTGTGAGCTTTGGGCGCCGCCTAAAAGATGCACCATCCAGGAACACACCACGGTTTACCCCTGGCG
  5   1   2       bld Tbd3 5g                IMAGE:3549041-IMAGp.IMAGp                   AATTTTCCCCCGGGGGATGGGGACTTGGGGCGAGCACAAGGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGGCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCACTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGGAGAAAAGCCCTTCTCGTGTCCACACTGCAACAGAGCATTCGCAGACAGATCCAACTTAAGAGCCCACCTGCGAACCCATTCTGATGTGGAAGA
  5   1   2       bld Neu4 5g3  out                   IMAGE:3556705.5p                                   GGTGAATGGACTGGGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGGCTCAGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCCCGCTAAAGATGCACATCAGGACACACACGTTACCCCTGCTGTGTAAAATTTGCGGCAAAGGCTTT
  5   1   2       bld Neu5 5g                           Neu5-121E4A.5p                                          GGACTGGGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTTCCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAATTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTG
  5   1   2       bld FaBN 5g3  out                   IMAGE:8074723.5p                                               TGGGCGAGCAAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAATCTGCGGCAAGCCTTTTCTAGACCGTGCTACTACANGGCACATCGCACTCACACTGGAGAAAGCTCTCTCTGTCACACTGCACAGACATCGCAGACGATCACTT
  5   1   2       bld Em10 5g3  out                   IMAGE:7981048.5p                                                GGCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGAGCACATCANGACAACACGTTACCCTGCGTATGTAAATCTGTGGCAAGCCTTTCTAGACGTGGCACTACAGGGACATCGCATCAACTGAGAAAGCCCTCTTTGTCCACTGCACGACATCCAACAATCACTTAGAGCACTGCGACCATCGAGTAGAATTCATGAGACGTC
  5   1   2       bld Ga15 5g                            XL483f05ex.5p                                                 GCGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAAAAGCCCTTCTCGTGTCCACACTGCAA
  5   1   2      seed Emb9 5g3  out                   IMAGE:7975866.5p                                                  CGAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAG
  5   1   2       bld Em10 5g                         IMAGE:8318460.5p                                                   GAGCACAAGATGCTATAAGGATCAGCTGGCGGGCGAGGACGAAACCATAATCGCTCCTCCTGGGGACCGTTACTTTAAGGGACCGTTACTTGTGCGTCCCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTATCCTACTCGCAAGCGATAGATGCTGA
  5   1   2       add Neu7 5g                              XL039n13.5p                                                                             TCCGCTTGAGGCCGGGGAGGAAACATAAGTAGCTCCTTGTGGGGACCGTTACTTTGCGAGGCTTGGGGTCCCCCTCCCTCACTGAAAATGCCACGCTCTTTTCTGGTCAAGAAACACTTCAACACGACCAAAAAGCCGAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGCTATCCCGTGTCCGTGCTACCCCAGCCTGACATCTACAGCTCGGTGGCCTACAGACCAATCACGGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGTCGGGTCAGCCCCCCTCCACAGTCGGATACGTCGTCTAAAGACCTCAGTGGCTCAGAGAGCCCCATCAGCGACGAGG
  5   1   2       bld Em10 5g                         IMAGE:8318628.5p                                                                                                                                                         CCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTATGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTATATGAGAGGTATCCTGTGTCTGTGCTACCCCAGCCTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGCGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGAAGAAAACTCCTTCTCGTGTCCACACTGCAACAGAGCATTCGCAGACAGATCCAACTTAAGAGCTCACCTGCAGACCCATTCTGATGTGAAGAA
  5   1   2       bld Tbd7      out                        XL085m19.5p                                                                                                                                                                                                                                                                                                         CTGACATCTACAGCTCAGTGGCCTACAGCCCAATCACTGTGTGGACAGGACTGCTTCACCCACCGCTGCCCAGTGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCACAATCTGACACATCGTCTAAAGACCATAGTGGCTCGGAGAGCCCCATCAGCGACGAGGAGGAGAGACTCCAAACCAAACTTTCCGACTCGCATGCGATAGAGGCTGAGAAATTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCTTGGGCGCGCTAAAGATGCACATCAGGACACACACGTTACCCTGCGTATGTAAAATCTGTGGCAAAGCCTTTTCTAGACCGTGGCTACTACAAGGGCACATCCGCACTCACACTGGTAAGTGGGAGCCCTATGCATGGGCCGGGTGATGCTGCCTTCCACTAACCCTCTAGGTGACACAGTGCTTATAACCCATAACCTCCGGCTGACACCCTAAAGTATTTAAACGTTGTATTATACATTGATGCAACCAATTTTCCCAGCCTATGGCACTGTTGGTGTGATATT
  5   1   2       bld Tad1      out                   IMAGE:6879526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGCGACGAGGAGGAGAGACTCCACACCAAACTTTCCGACTCGCATGCGATTGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGTCCAGTCTCGGAAATCATTTAGCTGCAAGTACTGTGAAAAGGAATATGTGAGCCTGGGCGCTCTGAAGATGCACATCAGGACACACACGTTACCCTGCGTCTGTAAAATCTGCGGCAAAGGGGTTTCTAGACCTTGGCTACTACGAGGACACATCCGCACTCACACTGGAGAAAAGCCCTTCTCTTGTCCACACTGCAACAGAGCATTCGCAGACAGATCCAACTTAAGAGCCCAGGTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTCGAAGGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGCTGTGGAGCACATTAGATCGTCATATGTTTACCAGGACTCCACGCCTCCTTCAGGGTTTCTGGTGTAAAAGAATTCCANACATATATTTCTTACCTCTTTTTTCCTTTCCTATGAAAAGGACAGCCTATGCAAGATCTACCAAAACGTCAGCATTTCAAGTCTGATTTGCAGTATGGATTACAAATAATAGAAACACTTTTCCGTATGGCAGGCAGGATTAATGAAATGGTCCTTAGATACGCCATATTTTCGTTGGCATGAATAAATCAAGCACATTTGTAGAGAATGGGCTCCTTGTCTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)