Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl317e10.3                           68 END     1           5        1                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:3436978-IMAGp.5                 7 END     1           5       14                (no blast hit)
     3   2.0    0Xl3.1-XL057n05.3                            3 END     2          11       66                (no blast hit)

 This cluster: approximate FL confidence score = 66%

 1012772909 Xl3.1-xlk140p12ex.3 - 17 ESTs
                                                                       ........0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk140p12ex.3         TCTGTAGCCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTCTT
                                                  Xl3.1-CHK-1012690686               GCCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTCTTACTGTG
                                                      consensus depths              2     2     5     5     7     7     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    11    10    11    10    11    11    12    11    12    11    12    11    12    11    13    11    14    11    15    11    15    11    15    11    15    11    15    12    16    12    16    12    16    12    16    12    16    12    16    12    17    12    17    12    17    12    17    12    17    11    16    13    16    13    16    13    16    13    15    13    15    12    14    12    14    12    14    11    14    12    14     9    13    10    13    10    13     9    13     9    13     9    11     8    10     8    10     9    10     8     9     8     9     8     9     7     8     7     8     7     8     6     8     5     8     5     8     4     7     4     7     4     7     4     6     3     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                         TCTATATGAACGATTCATCCGTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                             GCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCA
                                                                   SNP                                                                                             -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------TC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C----
                                               BLH ATG       5     126         
                                               EST CLI       0       6         
  5   1   2       bld Ooc3      out                   IMAGE:3436976.5p GACCTTGATCTGTAGCCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGT
  5   1   2       bld Egg1 5g                            PBX0112C02.5p         TCTGTAGCCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCTAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTTTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACT
  5   1   2       bld Ov1  5x3                        IMAGE:8331922.5p          CTGTAGCCATGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCTAAGTCTGGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTA
  5   1   2       bld Tbd7 5g3  out                        XL060b12.5p             GTAGCCTGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCTAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTTGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTTTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCCGCTCTCTACACCGTGTTCCCAACTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTAT
  5   1   2       bld Tbd7      out                        XL057n05.5p                   TGCCTTCGTTCAAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCTAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTTTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCCGCTCTCTACACCG
  5   1   2      seed Kid                             IMAGE:7012320.5p                        CCCACGCGTCCGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCACTCCTACTGTTCTTTTACATGN
  5   1   2       bld Ga12      in                         XL173k03.5p                          GGTTNAGGAGCGCCTCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGTACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCA
  3   1   2       bld Ga18      in                      xlk140p12ex.3p                                      CCTNCAGNACTTTCTCAACGGAGACANCTTCGTNTCTCGATTATTGGGGAAAGCTGAGGCGAAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGNCTTCTCTTGTCTGCAATCTGATTGNCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACNNNNNAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAANNNNNATGGCAA
  5   1   2       bld Ga18      in                      xlk140p12ex.5p                                         TCCAGAACTTTCTCAACGGAGACAACTTCGTATCTCGATTATTGGGGAAAGCTGAGGNNAAACTGGCATCAAAAAGTATTATCTTGCTACGGGATCCATCTGCTCCCTGGGGCTGTACCTTATATTTGGCTATGGGGCTTCTCTTGTCTGCAATCTGATTGGCTTTGTGTACCCAGCCTATATTTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGNCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTNCAAGCTGTAGGNTAANCATCAAGTTAATCTTTTCTTAGACAGCANCTATTTATTTCCAAGNCTACAGCAG
  3   1   2       bld Ooc3      out                   IMAGE:3436978.3p                                                                                                                                                                                                                            TACACGGTGAGTCATGCTAGTGAGATTCTTTCGACACATATATTCCTTTGGTTTCATATCTACAATCTGCCAAGTGTGCTTCTTAGTTTGGGGTATGGTTCCATTTCATGGAATGCTCTCAGCATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTTTTAAA
  5   1   2       bld Int2                            IMAGE:8526490.5p                                                                                                                                                                                                                                TTCGATTAAAGCTATTGAAAGCCAAGATAAAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCCCAACAAATTTTGAACACTTAAATTCAGACTAGTTGTGAACTGGTTATTCCCATGCCATAAATAAATTGTCCACGTGATCTAAGACCTATGATAATGTTTATTATGCTCTGAAGGTTTTCTCCAGTATGTGGCTTGTTATTCTTGTATCCTTACTGATATATCTCACTCTAAAATTTCAACAAACTTTCTCTTTTTATTCCTCATTTA
  3   1   2       bld Ga12      in                         XL173k03.3p                                                                                                                                                                                                                                                             AAAAAGATGACACGATATGGCTGACATACTGGGTGGTATATGGTGTGTTCAGTGTAGTTGAATTTTTCTCTGACATATTATTCTTCTGGTTTCCATTTTACTATCTGGGCAAGTGTTGCTTCTTAGTTTGGTGTATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGTACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCNGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTAAACACATAAATTCAGAACTA
  5   1   2       bld Gas4      in                    IMAGE:3421361.5p                                                                                                                                                                                                                                                                                                            AGGNATAAAAAACGGCNGATTGGNACGATNCCCGTTTGTGGNTGTAANATCTATATGAACGATCATCCGTCCTTCTTCCTGAAGCACCATCGAACGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACAGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGATTAGTTGCAGAACTCTCCTGGTACGTGAGGGAGGCCAACAAGTTTTTTCTAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTGTTGGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATACACTTTATAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAAATTTAACCCACTCCTACTGTTCTTTTACATTGNACATATGTGCAAGCTGGAGGTTAAGCATCAAGTTAATCTTTTCTTAAG
  5   1   2       bld Egg1      in                    IMAGE:4677928.5p                                                                                                                                                                                                                                                                                                                                 GCACGAGGGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTTTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCCGCTCTCTACACCGTGTTCCCAACTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTA
  3   1   2       bld Egg1      in                    IMAGE:4677928.3p                                                                                                                                                                                                                                                                                                                                        GGGAAGGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTTTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGTCCTGCATACCCTGACCAGCAGCAGAACTCTCCTGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCCGCTCTCTACACCGTGTTCCCAACTGTAACAATGATGTTATCCACTTTCTAGATCTGTCAATAAACAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTCTTACTGTGAAAA
  5   1   2       bld Ov1                             IMAGE:8332365.5p                                                                                                                                                                                                                                                                                                                                                                                                  TATGGCTCCATTTTCATGGAATGGCTCTCAGATTCTATATGAACGATTCATCCGTCCATTCTTCCTGAAGCACCATCGAACAGTGGACAGTGTTGTTAGTGACCTTGGAGGACAGGCGCTAAACACGGCTGAATCAGTCACTAGAGGAGCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTCTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTCTTACTGTGaaaaaaaaaaaaaaaG
  3   1   2       bld Gas4      in                    IMAGE:3421361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTGCATACCCTGCCCAGCAGCAGAACTCTCTGGGCACGTGAGGGAGGCCAACAAGCTCTCCCCAGCACCTCTCAATCAAAGGAGCAGTAACCCAGTCTTTGGAGAATGAAAAGTTGAAATGATTGCACTCTGCTCTNTACACCGTGTTCCCAAGTGTAACAATGATGTTATCCACTTTCTAAATCTGTCATTATTCAGTCCAAAGTCTGCAGCGGGATTTCTGCAAAACTTTAACCCACTCCTACTGTTCTTTTACATTGTACATATGTGCAAGCTGTAGGTTAAGCATCAAGTTAATCTTTTCTTAGACAGCACCTATTTATTTCCAAGTCTACAGCAGCACTTGTTCTGATCTTTATTTATTACCTCTGTAAAACAAGCAAAGCAGCAACAAATTTTGAAACACATAAATTCAGAACTAGTTTGTGAACTGGTTAATTTGCCATGGCAATAAAAGTAGAAATGTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)