Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8548382.5                       3 PI      94       1000     1691                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012772945 Xl3.1-IMAGE:4033118-IMAGp.5 - 24 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                   4     4     5     5     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    12    10    12     9    11     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7     9     7     9     7     9     6     8     5     8     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     5     5     6     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     7     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     8     7     7     7     7     7     7     8     8     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     6     8     5     8     4     7     4     6     2     4     2     4
                                               BLH MIN     210     309                              
                                               BLH OVR     210     457                              
                                               ORF LNG     210      90                              
  5   1   2       bld Tail                            IMAGE:8545800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTCAGCAACTACTGTATATGTGACATTACCAATGGCAATCATGGGACTGAAGGTCATCTTCCTGTTGGAATTGTGATGCCTACAGACTCCACTTGTGAGGTCGAAGCTTTGATGGtgaagatgaagcaacttcaagaaggcagagatgaagaagaagcaagtcaagaagagaTGGCAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTTCTACAGAAGATGAAGACCCTCCCCCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAACGTCNAAGAGATGTATGATGGTTTTGGAGACATTTAGCACTCTGAAAAGTACATGTAATTTGCTCTTATGGAGCGAGATGCAGGAGACTGCTTATGTCTGAAGCATTACTCATTTGACTGATTCTCTCTGCTGAGGAAAAGAAAAAACTCAAAACAGATGTGATGCAATTCGGTCGTCGAATTGCC
  5   1   2       bld Sp1                             IMAGE:5513215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATACATTGCTGCTCACTTTGATGTTCTTCCAACAGAGTTCACATTGGGAGATCAAAAACAGTATGGTGGATTtgagaacaagcaacttcaagaaggcagagatgaagaagaagcaagtcaagaagagatggcaactcgttttgagagagagaaAACTGAAAGCATGGTGTTTTCTACAGAAGATGAAGACCCTCCCCCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCTGAGAGCATTACTCGATATATGACCTGATTTCCTCTACTGACTGANGGaaaaaganaaaaaactacaaaaaacaaaGATGTTGAATGCAAATCTCCGGCTCGTCGA
  3   1   2       bld Neu7 5g3  in                         XL019b11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGCTTTGATGGTGAAGATGAAGCAACTTCAAGAAGGCAGAGATGAAGAAGAAGCAAGTCAAGAAGAGATGGCAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTTCTACAGAAGATGAAGACCCTCCCCCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCGAGAGCAATTACTCGATATAGACCNATTTCCTCT
  3   1   2       bld Tbd7      in                         XL083m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGCTTTGATGGTGAAGATGAAGCAACTTCAAGAAGGCAGAGATGAAGAAGAAGCAAGTCAAGAAGAGATGGCAACTCGTTTTGAGAGAGAGAAAACTGAAAGCATGGTGTTTTCTACAGAAGATGAAGACCCTCCCCCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCNCTGAGAGCAATTACTCGATATAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4968636.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCCCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCCTCTACTGACTGAAGGAAAAAAAAAAAAAAAG
  3   1   2       bld Sp1  5g3  in                    IMAGE:4964628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGATATAGATGTTTCCCGGCATTTTGAAGATACAAGCTATGGTTACAAAGACTTCTCCAGACGAGGGATGCATGTGCCTACTTTTCGAGTGCAGGATTACAGCTGGGAAGATCACGGCTATTCACTAGTTAATCGCCTGTATCCAGATGTCGGGCAGCTATTAGATGAGAAGTTCCACATTGCTTACAACCTGACTTATAATACCATGGCAATGCATAAAGATGTGGATACTTCAACTTTAAGACGCGCAGTATGGAATTATGTTCACTGCATGTTTGGTATAAGATATGATGACTATGATTATGGAGAAATCAACCAGCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCCTCTACTGACTGAAGGAAA
  5   1   2       bld Tbd7      in                         XL083f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTACTGGATCGCAGCTTCAAGGTTTACATTAAAAATGTGGTGTGCAGTCCTGAGAAAACGTCAAAGAGAATGTATGATGGTTTTTGGAGACAATTTAAGCACTCTGAAAAAGTACATGTAAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCCTCTACTGACTGAAGGaaaaaagaaaaaaaaactacaaaaaacaaaaGAATGTTGAAATGGCAAAATCTCCCGGCTCGCTCGGAAGACTATGGCAGCTGCCTTTTCCCGAAATCCTTTGTGCCATATTTCTCATCATATCAACTGTTGGCTTACTACCACCACCTACTTGTAGTGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTTTGGCCTTGTGTCTCGGACACATATGCTTGAACTTTGCTTTATAAGATAGCAGATGTTAACTGTATA
  5   1   2       bld Lu1                    IMAGE:4056923-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATTTGCTTCTTATGGAAGCGAGGATGCAGGGAGAACTGCTTTATGCTCTGAGAGCAATTACTCGATATATGACCTGATTTCCTCTACTGACTGAAGGaaaaaagaaaaaaaaaactacaaaaaacaaaaGAATGTTGAAATGGCAAAATCTCCCGGCTCGCTCGGAAGACTATGGCAGCTGCCTTTTCCCGAAATCCTTTGTGCCATATTTCTCATCATATCAACTGTTGGCTTACTACCACCACCTACTTGTAGTGAACTTGAAGTTGAATGTGTGAAGAAGAGATGCCAAGTTTTGGCCTTGTGTCTCGGACACATATGCTTGAACTTTGCTTTATAAGATAGCAGATGTTAACTGTATATCAGGATGTGGTTACAATGGTTCTATGAAAGACATTTCAAGAGGATGGACTGGGATATCTCTGCCTATTTTCCCTTTAGGTGCACACAGAAATGAGATTACGATGGCACTGCTATTTCAGTGATGGACTTTAGATGAGTAGAAGAAACAGTGAGGTGCAGGCAGCTGAATTAAGCTAAACGTGAACACATTGCTACAGTCTGAGCCTAGTTAAAGAGACTTACAGAATACATTTGTGCATGCTCTGAAGCTAGCCCTATTATATGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAGCTGTGAGGtttttttttttagtttttttCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAATTGTACATTAGTTTTTTGAGTCTTTAGTAGGTATGTTCTATACTATAAAACGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTACTCTGTTACTAGCAGTTAACGTTGGGAACAAAGG
  5  -1   0       add Lmb1                            IMAGE:8533160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGACGGAATCGGCTATTCCCTAGGCACACGAAGAGATCGATGCATGCTTTCAGGATGACTTAGAGAGTGAGAAACAGGAGTGCAGCAGCGATTTAGCTAACGGAACACATGCTACAGTCGAGCCTAGTAAAGAGACTACAGAATACATTTGGCATGCTCTGAAGCTAGCCCTATTATATGGCAACATACTTCCTTGCATACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAAGAAGCTGTGAGttttttttttttttttagtttttttCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAATTGTACATTAGTTTTTTGAGTCTTTAGTAGGTATGTTCTATACTATAAAACGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTACTCTGTTACTAGCAGTTAACGTTGGGAACAAAGGAACGCAGGCAGAAAAACCAGCTCGTGAGTGCACAATTTATTTGACACGCAACTCaaaaaaaaaaaGTCTTTTATTTCTCTTTCTTTCTTAACATCCAGTTCCAGGTCTGATGTTTAGATGCTGACTTTGAGGGAGGCAAAATAAAAACCGTTTAAAAAGGATGAACCCCATTGTGTTCTGAAAATATCAACATGAAAATATGCTATGAAAACTTAGTTGttttttttcaaagtctgtcagtattattgacaattttttttaaataaaacatgagaaaccataaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   0       add Tbd7      in                         XL083f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTCCTTGCANACTTCCCAGGTTCCATCTTGCTCTTTGGCTATGTGTTTAGTTATAANAAGCTGTGAGGTTTTTTTTTTTAGTTTTTTTCATAATGGTTGAAACTTAAGTTGTCTTCCTAAAAATTGTACATTAGTTTTTTGAGTCTTTAGTAGGTATGTTCTATACTATAAAACGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTACTCTGTTACTAGCAGTTAACGGGAACAAAGGAACGCAGGCAGAAAAACCAGCTCGTGAGTGCACAATTTATTTGACACACAACTCAGAAAAAAAAGTCTTTTATTTCTCTTTCTTTCTTAACATCCAGTTCCAGGTCTGATGTTTAGATGCTGACTTTGAGGGAGGCAAAATAAAAACCGTTTAAAAAGGATGAACCCCATTGTGTTCTGAAAATATCAACATGAATATGCTATGAAAACTTAGTTGTTTTTTTGTTTTTTTTCCAAAGTCTGTCAGTATTATGACAATTTTTTTTAAATAAAACA
  3   1   0       add Lu1                             IMAGE:4056923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGACTACAGGGAATGTAGAATACCTCTTGGTTATGGGGTGCACACTTTGTAACAGTTCCAATCTTTCTTTCAAGCTGCTACTCTGTTACTAGCAGTTAACGTTGGGAACAAAGGAACGCAGGCAGAAAAACCAGCTCGTGAGTGCACAATTTATTTGACACACAACTCAGAAAAAGCAAGTCTTTTATTTCTCTTTCTTTCTTAACATCCAGTTCCAGGTCTGATGTTTAGATGCTGACTTTGAGGGAGGCAAAATAAAAACCGTTTAAAAAGGATGAACCCCATTGTGTTCTGAAAATATCAACATGAATATGCTATGAAAACTTAGTTGTTTTTTTGTTTTTTTTCAAAGTCTGTCAGTATTATTGACAATTTTTTTTAAATAAAACATGAGAAACCATA

In case of problems mail me! (