Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7981240.3                       8 END     3          23       37                (no blast hit)

 This cluster: approximate FL confidence score = 80%

 1012772989 Xl3.1-IMAGE:8529495.5 - 13 ESTs
                                                                       ....-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8529495.5                                             TCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTCCGCTCTCTCTTTTGCGCTGGTTGGAACCAATGGGCAGGGGATTGGCACAAGCTCCCTGA
                                                  Xl3.1-CHK-1012693371                                                   CCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTxCxxxxxxxxxTTTGCGCTGGTTGGAACCAATGGGCAGGGGATTGGCACAAGCTCCCTGAGCCAAT
                                                      consensus depths                                                  2     3     3     6     9    11    10    11    10    11     9    11    10    11    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    11    12    12    12    12    12    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11     9    10     8     9     9     9     9     9     9     9     9     9     7     9     7     9     6     9     6     9     5     9     4     9     3     8     3     8     2     6     2     5     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                               BLH ATG       7     191                                             
                                               BLH OVR       7      29                                             
                                               EST CLI       8      14                                             
                                               ORF LNG       7       1                                             
  5   1   2       chi Emb9                            IMAGE:7976984.5p CCACCACTTTAGAAACATGCCGGACGGCTGATGCCTGATACCCTATAACTGACAGCTGAAGGAGGAAGGCTGAGGGCGGAGCTATGATGAGTGACGTCTGAGGAGGGAGGCTACAGAGCGGAGGTGTGACTGCGCATTTGGAGCATGCGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCCGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTTCTCCCAGTTCTGTAACAAGACGGCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAAGGGCAACTTGATCAGCTGCGGCGACTTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTTCCGCTCTCCTCTTTGC
  5   1   2      seed Ov1  5g3  out                   IMAGE:5074183.5p         GATATCGTCGACCCACGCGTCCGGGCGGGGTCACGGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGAGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCT
  5   1   2       bld Int2 5g                         IMAGE:8529495.5p                                          CGGTCCCTCCCATCATGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGAGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTCCGCTCTCTCTTGCGCTGGTGGAANCNATGGGCAGGGATTGCC
  5   1   2       bld Emb4 5g                         IMAGE:4680003.5p                                                GACGCGTGGGGGCCGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAACAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCAGGATAAAG
  5   1   2       bld Em10      out                   IMAGE:7981240.5p                                                      ATCCCGGGTCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTTCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGAGCCCTGTATGAGGAGCGTATGATCGGTGGTCACTCAGAAGTTTCGCTCCTCTTGCCTGGTGGACAATGGCAGGGATGGCCAGCTCCTAGCCATGGTCTGCTGTACCTCGACTCACTCGGAAGGAACTGACCTCTAACACG
  5   1   2       bld Ov1                    IMAGE:5074183-IMAGp.IMAGp                                                         TGACCGCCTCCATGTGCGACGTGTTCGCCTTTTGCGCTGAGCAGGAGCCGGCGCGTCTGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGGTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCCACACCGCCGACGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCTAAATGGATTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCCAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGAGACCTCCAGGGATAACCCGGCACATCCCCTCAA
  5   1   2       bld Neu7      out                        XL012m08.5p                                                             CGCCTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCACTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAATGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAA
  5   1   2       bld Tail                            IMAGE:8544339.5p                                                                CTCCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAATGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTCCGCTCTCTCNTGCGCTGGTTGGACCATGGGCAGGGGATGGCACAGCTCCTGAGCCCATGGTCATGCTGCGACGCTCTAACTCCACTCG
  5   1   2       bld Em10                            IMAGE:8318334.5p                                                                  CCATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCCGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGGTATGAGTCGGTGGTTCACTCCAG
  5   1   2       bld Em10                            IMAGE:7983689.5p                                                                   CATGTGCGACGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCGTCGGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTTCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTTGATCACTCCAGAGGGTTTCGCTCTCTCTATGCGCTGGTGGAACCAATGGGGG
  5   1   2       bld FaB                             IMAGE:8073383.5p                                                                   CCCCTTAAAGGTGTTCGCCTTTTGTGCTGAGCAGGAGCCGGCGCCTCTGACAGTGGAGATTCGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCCGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAAGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAAGAGCGTATGAATCGGTGGGTCACTTCAGAAGTTTCCGCTCTCTCTTTGCG
  5   1   2       bld Ga15                               XL436l09ex.5p                                                                                                                                CGCTTTGTCAGCAGCGGGAAGGGGAAAGGTCTGTTCGCTATTCGGACCATACGGAAAGGGGAGACGATATTCCAGGAAAAGCCGCTGGTATCGTCCCAGTTCCAGTGGAATGCGCTGTACCGGTATCGGGCTTGTGATCACTGCCTGCGCTCCCTCGAGACCGCCGAGGAGAATGCCCAGAGACTGTCTGGAAATGCCCACGTGCTCCTCCCATACCCAGAGCTCTGCACGGTCCGAAATGGACTGCACCAGCAATGCCCGCGATGCCAGGTGACGTACTGCAGTGCCGAGTGTCTCAAAGCCGCCGCGGAGCAGTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCANAAGGTTTCCGCTCTCTCTTTGCGCTGGTTGGAACCAATGGGCAGGGGATTGGCACAAGCTCCCTGAGCCAATGGGTTCATGCCTGCGACGCTCTANAGCTCCCACCTCNG
  5   1   2       bld Ga15                               XL407j19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTACCACCAAATCCTCTGCCTTGGGACCTCCAGGGATAACCCGGCACATCCCCTCAATAAACTGGAGGAGGCCTGGAGAAATATGCATTACCCTCCTGAGACTGCCAGTATCATGCTCATGGCACGGATGGTGGGCACTATTAAACAGGCCCAGGATAAGGACTGGTGGCTGCACCTTTTCTCCCAGTTCTGTAACAAGACGGCCAATGAGGAGGAGGAGATTGTCCATAAGCTGCTGGGAGAGAAGTTTAAGGGGCAACTTGATCAGCTGCGGCGACTTTTCGTGGACGCCCTGTATGAGGAGCGTATGAGTCGGTGGTTCACTCCAGAAGGTTTCCGCTCTCTCTTTGCGCTGGTTGGAACCAATGGGCANGGGATTGGCACAAGCTCCCTGANCCAATGGGTTCATGCCTGCNACNCTCTANANCTCCCACCTCGGGACANGGNAAAANCTGGACGCTCTCATANACCAACTGTACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)