Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL097h12.3                           14 END     3           9       21                bone morphogenetic protein 4 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL097h12.3                           14 PI      96       1457     2124                bone morphogenetic protein 4 [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012773061 Xl3.1-IMAGE:8078406.5 - 31 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8078406.5                           ACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGCTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCGGAATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGACCCCCCCCGCCCCGGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATAAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGT
                                                  Xl3.1-CHK-1012687990                                 TCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGCTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCGGAATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGACCCCCCCCGCCCCGGGTGCCTCTGTGGAACTGTCCTTGTCCTxxxxxCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGAxxxCATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCxGxCxxTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATAAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAA
                                                      consensus depths                                2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     4     6     6     7     5     6     5     6     5     6     5     6     5     6     5     6     6     6     5     8     6    11     6    14     6    14     6    14     6    13     6    13     6    11     6    13     6    13     6    13     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     8    15    15    15    14    15    15    15    15    15    15    15    15    15     7     9     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10     9     9     9     9     9     9     8     8     8     8     8     8     8     8     7     7     7     7     7     8     8     8     7     8     8     8     6     8     6     8     8     8     7     7     7     7     6     6     6     7     7     8     7     8     6     8     8     8     9    10     8     9     6     9     7     9     8     9     9     9     9     9     7     9     7     9     8     9     8     9     7     9     6     9     7     9     7     8     7     8     7     8     6     7     6     8     8     8     8     8     7     8     8     9     8     9    10    10    10    10     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     7     9     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     6     8     6     7     5     5     4     4     3     3     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATCTCCATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGCTTTCATCCCGCTCTATCACTTGATTTTGTTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTCTAATCCCCCGCAGATCCTCCCTATTTATTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTGTTTTTCTATGCCTTGTTTTGTGTCAAGACAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCCGACATTCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               G--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---C------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---T-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G--------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C--------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                               BLH ATG     781     988                           
                                               BLH MIN     781     274                           
                                               BLH MPR     268     274                           
                                               BLH OVR     781     858                           
                                               ORF LNG     781      62                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-035     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 3e-046     NP_001071663.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 7e-046     XP_874937.3 PREDICTED: similar to bone morphogenetic protein 6 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 2e-072     NP_722813.1 decapentaplegic CG9885-PE [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---= 4e-078     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 7e-100     NP_001116977.1 bone morphogenetic protein BMP2/4 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 3e-161     NP_571417.1 bone morphogenetic protein 4 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 0          NP_990568.1 bone morphogenetic protein 4 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 0          NP_031580.2 bone morphogenetic protein 4 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 0          XP_547817.2 PREDICTED: similar to Bone morphogenetic protein 4 precursor (BMP-4) (BMP-2B) isoform 1 [Canis familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 0          NP_570912.2 bone morphogenetic protein 4 preproprotein [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 0          NP_001039342.1 bone morphogenetic protein 4 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAY90071.1 BMP4 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          NP_001081501.1 bone morphogenetic protein-4 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8078406.5                                                 TGA------------------------------------------ATG------------ATG---------------------------------------------------------------------TAG---------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------ATG------------------------------------------------ATG------------------------------------------ATG---------------TAG------------------------------------------------ATG------------TGATAATGA---ATGTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TGA---TGA------------------------------------------------------TGA---------TGA---------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Ga18                               xlk71l17ex.5p GAGCCAGTTCCTTAGTATCATCTGCAAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGNTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCNNATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGNCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGNACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGANGNTCTCAGTCAGATTAGCAACAGGATGGCGGTGANTATCTGATAATGAGGGATGTGACTGGACACAAGNTATAACTCAAGAccccccccgccccGGGTGCCTCTGTNGNANTGTCCTTGTCCTATTATTTGCTTTCATCCNCTCTATCACTTGATTTTGTTGTCAGNCTAATCCCCCNGCAGANCNNCC
  5   1   2       bld DMZ       in                         xl338g04.5p   CACGAGGCTTAGTATCATCTGCAAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGCTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCGGAATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGAccccccccgccccGGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATTTGCTTTCATCCCGCTCTATCACTTGATTTTGTTGTCAGTCTAA
  5   1   2       bld FaBN                            IMAGE:8076744.5p                     CTGCAAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGCTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGGCTCGCGGAATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGAccccccccgcccccGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATTGCTTTCATCCCGCTCTATCACTTGATTTTTTTGTCAGTCTAATCCCCCGCAAATCCTCCC
  5   1   2       bld Ga12      in                         XL144d24.5p                        GGCAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCACCCATTTCTGTCAAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAGTGAGTAGACTTTCTGTTCCTCTTGTATTTCTCATCTTCTCTGTTCTTTGCCTGTAGCTGTCCCCCTGCATAGGAACCCCCCACACACGGCTCTGGCTACTTCCTGCTGCCGACCCGACAATCAGTTGAGTCGCCCCGACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCGGAATTAGGGGGTGTAGCGTGTTGTANTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAAT
  5   1   2       bld Tbd7      in                         XL061f15.5p                                                                                                                                                                                                                                                                         ACGCGCTCTAGGACACAAGTGTGCTGCCCATGTACAACTGCAGGTGTTGGAGAACTACAAGTACCAGCATTCATTGGCCAGCCTCGCGGAATTAGGGGGTGTAGCGTGTTGTAGTTCTTTAGCAACTGGATTGCCGAGCGCTTGGGCTGCAGTGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGA
  5   1   2       bld Egg1 5g                            PBX0146E05.5p                                                                                                                                                                                                                                                                                                                                                                                                                            ACGAGGGGGACTGATAACATGTATCACAGCTGGAGCGCGGACATATCGCAGGCTATCGGGTTGCAGCACATGATCCAGCTGCTCGGAGCGCCGGCACTTGTTGCACAGGGGCAAATGGCAGAGGCATTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGAccccccccgccccGGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATTTGCTTTCATCCCGCTCTATCACTTGATTTTTTTGTCAGTCTAATCCCCCGCAGATCCTCCCTATTTATTTGCATGTATTTTGTTTGTTGTGCACCCTCCAGAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGC
  5   1   2       bld Ga18 5g                           xlk151e07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGGGTTGNAGCACATGATCCAGCTGCTCGGAGCGCCNNNCTTGTTGCACAGGGGCAAATGGCAGAGNNTTTCTATAGCGACTGCTGCCAATTGCGGGAGACGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGAccccccccgccccGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATTTGCTTTCATCCCGCTCTATCACTTGATTTTGTTGTCAGTCTAATCCCCCGCAGATCCTCCCTATTTATTTGCATGTATTTTGTTTGTTGTGCACCCTCCAGAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGNCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGNCTCGGNAA
  5   1   2       bld Ga12 5g3  in                         XL183h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCTCTCAGTCAGATTAGCAACAGGATGGCGGTGACTATCTGATAATGAGGGATGTGACTGGACACAAGTTATAACTCAAGAccccccccgccccGGGTGCCTCTGTGGAACTGTCCTTGTCCTATTATTTGCTTTCATCCCGCTCTATCACTTGATTTTGTTGTCAGTCTAATCCCCCGCAGATCCTCCCTATTTATTTGCATGTATTTTGTTTGTTGTGCACCCTCCAGAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAAT
  5   1   2       bld Ga18 5g                           xlk158h11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCCAGTTCTATAGTATCATCTCCATCCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAA
  5   1   2       bld Ga15 5g                            XL496k12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGTTCTATAGTATCATCTCCATCCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAA
  5   1   2       bld Tbd7 5g3  out                        XL097h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTCTATAGTATCATCTCCATCCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTTCCCGCTTATATGCGCGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTGCACGATATCAGCATGGAGTACCCCGAGACACCCACCAGCCGCGCCAACACCGTGAGGAGCTTCCATCACGAGGAACATTTGGAGAATCTACCAG
  5   1   2       bld Ga15                               XL437p12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCCTTAGTATCATCTGCAAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGCAA
  5   1   2       bld DMZ                                  xl276h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCCTTAGTATCATCTGCAAACTGCGTCCCGAGCCCGTGCACTGAGCTTTTCCACCCATTTCTGTCCAAGATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATNAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACAC
  5   1   2       bld Tbd7 5g3  out                        XL109p12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCCATCCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTTCCCGCTTATATGCGCGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTGCACGATATCAGCATGGAGTACCCCGAGACACCCACCAGCCGCGCCAACACCGTGAGGAGCTTCCATCACGAGGAACATTTGGAGAATCTACCAGGCACAGAAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACC
  5   1   2       bld Ga18 5g                           xlk151i05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCCATCCGCGTCCTCGAGCCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGCC
  3   1   2       bld Tbd1                                 AW764614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCATCCGCGTCCTCGAACCCCACTGAGCTTTTCCACACATTTTTTGTGTCCAACATTGGCTGTCAAGAATCATGGACTGTTTTTCTATGCCTTGTTTTCTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCA
  5   1   2       bld Sp1                    IMAGE:4173707-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGGACTGTTTTTCTATGCCTTGTTTTGTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGCAATCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATAAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAACAAACAT
  5   1   2       bld Sp1       in                    IMAGE:4173707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGACTGTTTTTCTATGCCTTGTTTTGTGTCAAGACATCATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTATGCCAAGTCCTGCTCGGAGGCACTAACCATGCCAGCCTCATACCTGACACGGGCAAGAAGAAAGTAGCGGCCGACATTCAGGGGGGTCGGAGGTCCGCTCAGGGCCATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGCCTCGGCAATCGGCCGCAGCCCAGTAAGGATGTGGTGGTGCCCGCGTATATGCGCGACCTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTNTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATAAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTTGCATTATGAAGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAG
  5   1   2       bld Tbd7 5g3  out                        XL052m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGATTCCTGGTAACCGAATGCTGATGGTCATTTTATTAAGCCAAGTCCTGCTCGGAGGCACTAACTATGCCAGCCTGATACCTGACACGGGCAAGAAGAAAGTCGCGGCCGACATTCAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTTCCCGCTTATATGCGCGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTGCACGATATCAGCATGGAGTACCCCGAGACACCCACCAGCCGCGCCAACACCGTGAGGAGCTTCCATCACGAGGAACATTTGGAGAATCTACCAGGCACAGAAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGA
  5   1   2       bld Ga12                                 XL141k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGACATTNAGGGAGGAGGTCGCAGGTCGCCTCAGAGCAATGAGCTCTTGCGGGATTTCGAGGTGACGCTGCTGCAGATGTTCGGACTCCGCAAGCGGCCGCAGCCCAGTAAGGATGTGGTGGTTCCCGCTTATATGCGCGACCTGTACAGGCTTCAGTCAGCGGAGGAGGAGGATGAACTGCACGATATCAGCATGGAGTACCCCGAGACACCCACCAGCCGCGCCAACACCGTGAGGAGCTTCCATCACGAGGAACATTTGGAGAATCTACCAGGCACAGAAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATCACAGCAAACGGACACATGATAAATAGGCTGCTGGACACGAG
  3  -1   2       bld Egg3      in                    IMAGE:3378119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTACAGGCTTCAGTCGGCGGAGGAAGAGGATGAGCTGCACGATATCAGCATGGAGTATCCTGAGAGACCGACCAGCCGCGCCAACACTGTGAGGAGCTTCCATCACGAGGAGCATTTGGAGAATCTACCAAGCACAGCAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATAGATATGAAGTTATGAAGCCCATAGCTGCAAATGGACTCATGATAGATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTGTTGATGTAAGCCCTGCGATGATGANGTGGACCCGGGATAGACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTTAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGGATGCAAGGGACGTGCACTGACCCAGAAGGTCAA
  5   1   2      seed Ga15                               XL453o24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGAATCTACCAGGCACAGAAGAAAATGGAAATTTCCGTTTTGTGTTCAACCTCAGCAGCATTCCAGAGAATGAGGTGATTTCTTCAGCAGAACTGAGACTCTATAGAGAACAAATAGACCATGGTCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATCACAGCAAACGGACACATGATAAATAGGCTGCTGGACACGAGGGTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCTGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACAAAAACTTATCAGGGGAAGCATGTAAGGATAAGTCGATCTTTATTACCTCAAAAGGATGCAGACTGGTCACAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGGCATGCACTGACTAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTaaaaaaaaTAAACACTGCCGGAGACATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGATTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACTCAAGCATCCCAAAAGCATGCTGCGTCCCCACAGAACTGANTGCTATCTC
  5   1   2       bld Gas5                            IMAGE:3748174.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGCAGAAAATGGAAATTGCCGTTATGTGTTCAACCTCACCACCATTCCAGAGAATGAGGTGATTTCTTCATCACAACTGAAACTCTATAGAGAACAAATAGACCATGGTCCATCGTGGGATGAGGGTGTCCACCGGATAAATATATATGAATTTATGAAACCCATAGCTGCGAATGGACTCATGATAAATATGCTGGTGGACACGAGACTAATCCACCACAATGTGACACAGAGGGAAAGTTAAGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAACATATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCACGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCATACTGGTCTCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGTGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTTAAAAACTCACACATTGACTGGAGCATTCTCTGTATGTGGATATCAGCGATGTGGGACTGGATGACTGGATTGTGGCACCTTCTGGATACCAGGCCTATTACTGCGTAGGAGAT
  5   1   2       bld FaBN                            IMAGE:8078406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCAGCGTGGGATGAGGGTTTCCACCGGATAAATATATATGAAGTTATGAAACCCATAGCTGCAAATGGACTCATGATAAATAGGCTGCTGGACACGAGACTAATCCACCACAATGTGACACAGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAACAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTaaaaaaaaCAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCANGAGATGGTGGTGGAAGGGTGTGGGTGCCNTTGAGTCTGAGATCCAACAATAAACTGTTAAGGCTGGACTTCTTTCACTGAACATTCACTTGACCTTATTATGACTTTATGTGCAAAGT
  3   1   2       bld Ga12 5g3  in                         XL183h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGGGAAAGTTTTGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAAGAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATATGATCATATATTTGACAAAA
  3   1   2       bld DMZ       in                         xl338g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATGTAAGCCCTGCAATTATGAGGTGGACCCGGGATAAAGAGATAAACCATGGGCTTGCCATTGAGGTCATTCACCTCAANCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTGA
  3   1   2       bld Tbd7      in                         XL061f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACCATGGGCTTGCCATTGAGGTCATTCACNTCAACCAAACCAAAACTCATCAGGGGAAGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATANATCATATATTT
  3   1   2       bld Sp1       in                    IMAGE:4173707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTGCCATTGAGGTCAATTCACCTCACCCAAACCAAAAACTCATCAGGGGAAGGCATGTACGGATAAGTCGATCATTATTACCTCAAGAGGATGCAGACTGGTCGCAGATGAGACCACTTTTAATTACATTCAGCCATGATGGCAGGGGACATGCACTGACCAGGAGGTCAAAAAGAAGTCCAAAACAGCAGAGACCCCGTAAAAAAAACAAACATTGCCGGAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTA
  5  -1   2       bld Egg3      in                    IMAGE:3378119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCCGGAAGGCATTCTCTTTATGTGGATTTCAGCGATGTGGGCTGGAATGACTGGATTGGGGCACCTCCTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGCTATTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTATGTGCAAAAGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTaaaaaaaaaaaaaaaaaaaaGCGGCCCCCGG
  3   1   2       bld Ga12                                 XL194n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAATGTCTGGATTGTGGCACCTCNTGGATACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGCTGATCACCTAAACTCAACTAACCATGNTATTGTNCAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAANTGAGTGCTATCTCCATGCTTTATTTGGACGAATATGACAAAGTCGTCCTTAAAAACTACCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGNCTGGANTTCTTTCCACTGAACATTCACCTTGACCTTATTTATGACTTTTANGTGCAAAAGTTTTGACAATATGATCATATATTTTGACAAAATATATTTATAACTACGTATTAAAAGAAAAAAAAAT
  3   1   2       bld Ga12      in                         XL144d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACCAGGCCTTTTACTGCCATGGAGATTGTCCATTTCCCTTGGATGATCACCTAAACTCAACTAACCATGNTANTGTACAAACTCTGGTAAACTCTGTTAACGCAAGCATCCCAAAAGCGTGTTGCGTCCCCACAGAACTNAGTGCTATCTCCATGCTTTANTTGGACGAATATGACAAANTCGTCCTTAAAAACTNCCAGGAGATGGTGGTGGAAGGGTGTGGGTGCCGTTGAGTCTGAGATCCAAACAATAAACTGTTAAGGGCTGGACTTCTTTCCACTGAACATTCACCTTGACCTTATTTATACTTTTATGTGCAAAAGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)