Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5079690.5                     218 PI      90          1      852                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012773064 Xl3.1-IMAGE:4930071.5 - 10 ESTs
                                                                       .....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4930071.5                                                                            TTCGCTTCTCTCCCGGCTGGGCACGTGACGGGTTTTTTTTTCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCATCATGACCACGACCATCACGACCATGACCATCACGATCATGACCATGATGACGATAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCCAAAGACGGGTGAATATGAAAGAGAACATGCAAAACGACCAGATGCAGACCTAAAATCTTATTTTACAGATAAGAAAACTCATCTTTACACCC
                                                  Xl3.1-CHK-1012695524                                                                                  TCTCTCCCGGCTGGGCACGTGACGGGTTTTTTTTTCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCATCATGACCACGACCATCACGACCATGACCATCACGATCATGACCATGATGACGATAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCCAAAGACGGGTGAATATGAAxxxxAACATGCAAAACGACCAGATGCAGACCTAAAATCTTATTTTACAGATAAGAAAACTCATCTTT
                                                      consensus depths                                                                                 2     3     3     6     4     7     7     7     6     7     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     8    10     9    10     9    10     9    10     9    10     9    10     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     7     9     7     9     6     8     5     7     5     7     5     7     4     6     3     6     2     6     2     6     3     5     3     4     3     4     3     3     2     3
                                               BLH ATG      98    1182                                                                            
                                               BLH MIN      98     136                                                                            
                                               BLH MPR      98     136                                                                            
                                               BLH OVR      98      25                                                                            
                                               CDS MIN      98     136                                                                            
                                               EST CLI      -5      10                                                                            
                                               ORF LNG      98       1                                                                            
                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-047     NP_499176.1 calnexin (69.2 kD) (cnx-1) [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-048     NP_001036767.1 Calnexin 99A CG11958-PD, isoform D [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ag ---- 4e-049     XP_313899.4 AGAP005032-PB [Anopheles gambiae str. PEST] ------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 3e-068     XP_001177910.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 2e-088     NP_998613.1 zgc:63524 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 2e-092     ACB72403.1 calnexin alpha [Xenopus epitropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 2e-092     ACB72404.1 calnexin alpha [Xenopus (Silurana) sp. new tetraploid 1] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Cf ==== 7e-103     NP_001003232.1 calnexin [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Bt ==== 6e-103     NP_001099082.1 calnexin [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Mm ==== 2e-104     NP_001103970.1 calnexin [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Hs ==== 4e-106     NP_001019820.1 calnexin precursor [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 2e-107     NP_001025791.1 calnexin [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 3e-135     CAJ82368.1 calnexin [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 3e-151     NP_001080326.1 calnexin [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4930071.5                                                                                                                                                               TGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Emb1 5g                         IMAGE:6637416.5p GCTAGGAAAGGTGGAGCCGTGAGAGGATTTTCAGACAACAGCGCCGCTCATTTACAGCTTATCGCTCCTCCCCAATTCGCTTCTCTCCCGGCTGGGCACGTGACGGGtttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacgaTAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCTTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTTCAAAACTCAAGAACAGAAAACCGGAGCAGTTTTCAAGATAAAACACCCTACACGATCATGTTTTGGCCCTGACAAGTGTGGGAGAGGATTACAAACTGCATTTTTATTTTCCGGGCACAAGAACCCAAAGACGGGTTGAATATGAAGAAGAAACCTGCCAAAACGACCCAA
  5   1   2       bld Emb1 5g                         IMAGE:5155440.5p                                                                CCACGCGTCCGATTCGCTTCTCTCCCGGCTGGGCACGTGACGGGtttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacgaTAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTTCCGGCACAAGAACCCAAAAGACGGGNTGAATATGNAAGAGAAAACT
  5   1   2       bld Ga18 5g                            xlk78d13ex.5p                                                                       CCTCCCCAATTCGCTTCTCTCCCGGCTGGCACGTGACGGGtttttttttCTGCAGCGCNNACTTGGAGGGCACTGGTGTNNGGGGAGNTNAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCATCatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacgaTAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATTAAAGATACAAAGCTCCCAGGGGNCCTGGGCCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGNTAGNTTTCAAAATGGAATTGAATGTGGGGGTNNATATGTGAAANTACTTTCCAAAACTCAAGAACAGAAACCGGNGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTNGNCCNTGACA
  5   1   2      seed Emb1 5g                IMAGE:6633667-IMAGp.IMAGp                                                                             CGCTTCTCTCCCGGCTGGGCACGTGACGGGttttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacgaTAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCA
  5   1   2       bld Emb1 5g                         IMAGE:6633667.5p                                                                              GCTTCTCTCCCGGCTGGGCACGTGACGGGttttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCatgatcatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacGATAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTNGACAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCAAAGACGGGTGAATATGAAAGAGAACATGCANAACGACCAGATGCAGACCTAAAATCTTTATTTTACAGATAAGAAAACTCATCTTTTACACCCTTAGTCCTAAAATCCCTGATAAACAACTTTGAAAATCCTGA
  5   1   2       bld Emb1 5g                         IMAGE:6863468.5p                                                                                 TTCTCTCCCGGCTGGGCACGTGACGGGtttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGatcatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacGATAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAAAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCCAAAGACGGGGTGATATGAAGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTTATTTACCGATAAGAAAACTCATCTTTACACCCTAGTCCCTAATCCTGATAACACTTTGAA
  5   1   2       bld Ga15 5g                            XL482p13ex.5p                                                                                                GCACGTGACGGGtttttttttCTGCAGCGGCGGACTTGGAGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGATCatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgacgaTAATGGGCTGGACATTGATGATGACCTANAANAGCCTGAANAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCANAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCANAAGCCCTTTGTCTTTGATAANAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGG
  5   1   2       bld Emb4 5g                         IMAGE:4930071.5p                                                                                                                                       AGGGCACTGGTGTGCCGGGGAGGCTGAATCACTGTGATCATGGATCTGAAATGCTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAaatgctcatgatcatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgatgACGATAATGGGCTGGACATTGATGATGACCTAGAAGAGCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCCAAAGACGGGTGAATATGAAAGAGAACATGCAAAACGACCAGATGCAGACCTAAAATCTTATTTTACAGATAAGAAAACTCATCTTTACACCCCTAGTCCCTAAATCCTGATAAACACTTTGAAAATCCNTGGGTTGGATCAAAACTGGTTGTAAAAACCCGTTGGGA
  5   1   2       bld Tbd7                                 XL061e03.5p                                                                                                                                                                                                                                    ATAaatgctcatgatcatcatgaccacgaccatcacgaccatgaccatcacgatcatgaccatgATGACGATAATGGGCTGGACATTGATGATGACCTANAANANCCTGAAGAATTAAAGCCGGAGACCAGCATGCCGCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGAAGTCTATTTTTCAGAATCATTTGACAAAGGAAGTTTGGACGGGTGGATTCTCTCCAAGGCCAAGAAAGACGACACAGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTCACAGAAATGAAAGATACAAAGCTCCCAGGGGACCTGGGCCTTGTCCTAATGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATA
  5   1   2       bld Gas8                            IMAGE:3516672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTCACAGAAATGAAAGATACAAAGCTCTTTATTGTGGACCTGGGCCTTGTCCTAGTGTCACGTGCAAAACACCATGCAATTGCCGGCAAACTTCAGAAGCCCTTTGTCTTTGATAAGAAACCTTTAATTGTACAATATGAAGTTAGTTTTCAAAATGGAATTGAATGTGGGGGTGCATATGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCGGAGCAGTTTCAAGATAAAACACCCTACACGATCATGTTTGGCCCTGACAAGTGTGGAGAGGATTACAAACTGCATTTTATTTTCCGGCACAAGAACCCAAAGACGGGTGAATATGAAGAGAAACATGCTCAACGACCATATGCAGACCTAATATCTTATTTTACAGATAAGAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)