Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8077705.5                       3 PI      91         62      702                RAB9A, member RAS oncogene family [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012773144 Xl3.1-xl319h16.3 - 14 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl319h16.3                GCCACTAGGAACTAGCAGAGAACCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGATTTTTGACTTAGGATCTAATAAAATACTTCAC
                                                  Xl3.1-CHK-1012692063                      AGGAACTAGCAGAGAACCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGATTTTTGACTTAGGATCTAATAAAATACTTCACTGAAGT
                                                      consensus depths                     2     2     2     4     4     6     4     6     5     7     5     7     5     7     7     9     7     9     8     9     8     9     8     9     8    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    12    13    10    12    11    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     7     9     6     9     7     9     7     9     7     9     7     9     7     9     6     9     6     9     5     8     5     8     5     8     5     7     5     7     5     6     5     6     4     5     4     5     4     5     4     5     4     4     4     4     3     3     3     3     3     3
                                               BLH ATG     106     819                
                                               BLH MIN     106     127                
                                               BLH MPR      91     127                
                                               BLH OVR     106     608                
                                               CDS MIN     106     127                
                                               EST CLI      -9       1                
                                               ORF LNG     106      14                
  5   1   2       bld Egg1 5g                            PBX0082B01.5p GCACGAGGGCGAAGCGCCACTAGGAACTAGCAGAGAACCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTGCTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGA
  5   1   2      seed DMZ  5g3  in                         xl319h16.5p                GCCACTAGGAACTAGCAGAGAACCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGC
  5   1   2       bld Ov1       in                    IMAGE:5048336.5p                        GAACCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTNACAAAATCCTCACTGCTGAAAANTCATTCNNTTCTGGGAAGAAATGGAGGAAAGTTGGAAAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073183.5p                           CCACGCGTCCGCCTGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTCTACAGGTGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCG
  5   1   2       bld Lmb2 5x3                        IMAGE:8637438.5p                                   TGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTATACTACAATTACAATGTCTACGAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACCGTTGAGGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACGGGTTACCTGCNAAGAAACATAAGCAACTACTGCTTGCTGTTGACTCTGCATTGAAAGTCATAACCTGTAAACCTTATCCAGCATGCAGCCATCAGTATGATGGTGTCAGCTGTACATGTTGGTGACTAATGAGATACTATATTAGTCGTAGATCATCAATATCGATGTTGCTAAGACGTCACTCT
  5   1   2       bld Te2N 5x3                        IMAGE:7204576.5p                                        TGGAGAGACTGGGTCGCAGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCAACTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCCATGCAGCCCATCAAGTATGAGGTGGGTGGTCATGCATGTAGCATTGTTTGGGGTGAACTAAAATGAGAATATCTAATTATTTAGGTTCTGTTCAGGAATCTAATCAAAATAAATTCAGAATTGGGTTTGACCTAAAACGAACCTGTTTCCAGCTTCC
  5   1   2       bld Eye1 5x3                        IMAGE:6946081.5p                                                         AGATGCTGCCTGATGTTAAAAACTGAAGTGATAAAATAAGATCATCACTTTAAAGGAAAACGGTGTCTATTACAATGTCTACGAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACCGTTGAGGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGGGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGGCAAAGAAAAACATAAGCCCAACTACCTGCTTTGGCTGTTGAACTCCTTGGCATTTTGGAAAAGTTCAAATaaccccctggaaaaaaccccctttttattccccccacccccTATGGGCCAAAGGCCCCCCTATTTCAAGGGGGC
  5   1   2       bld Egg1 5g3  in                    IMAGE:4678378.5p                                                                                                    ATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTT
  5   1   2       bld Egg2 5x3               IMAGE:4678378-IMAGp.IMAGp                                                                                                    ATCACTTTAAAGGAAAACTGTGTCTATTACAATGTCTACAAAATCCTCACTGCTGAAAATCATTCTTCTGGGAGATGGAGGAGTTGGAAAAAGTTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCAT
  3   1   2       bld DMZ  5g3  in                         xl319h16.3p                                                                                                                                                             AAATCATTTTCTGGGAGATGGAGGAGTTGGAAAAAGNTCTCTCATGAATAGATACGTCACTAATAAGTTTGACACACAGTTATTCCACACAATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGATGGTCACATGGTAACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCCTTTTACAGGGGATCCGATTGCTGTTTACTCACATTCAGTGTTGATGATTCTCAGAGTTTTCAAAACCTGACCAATTGGAAAAAGGAATTTATATTCTATGCAGATGTCAAAGACCCTGACAACTTTCCGCTTGTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGA
  5   1   2       bld Te2N                            IMAGE:7767804.5p                                                                                                                                                                                                                                                                                               ACGGTCATCTGGTTCAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTCAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGTTCGGAGGGTTTTAGCCATAGAGGATAGATCAGATCAACTGATACACACAGATACAGTTAACCTGCATAGAAAACAAAAGCCAACTACTTCCTGCTGTTGACTGTTGCATGTGAAAGGCAATAACCCTTTAACCCCTTTATCCCAGCCATGCAAGCCCATAAAGTATGAGTGGGTGGCCATGCATGTAGCATTGTTTGGGTGAACGAAATGGAGAATATCTAATATTTATGTCTGCCAAGACATCTAATCAAAATAATTCATATTG
  3   1   2       bld Egg1 5g3  in                    IMAGE:4678378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGTCTTGGGAAACAAAATAGACATGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGATTTTTGACTTAGGATCTAATAAAATACTTCACTGAAGTCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ov1       in                    IMAGE:5048336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGGAAACAAAATAGACCTGACAGACCGCCAGGTGACAGTTGAAGAGGCCCAAGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAACGTTGCTGCAGCATTTGAAGAAGCTGTTAGGAGGGTTTTAGCCATAGAGGATAGATCCGATCAACTGATGCACACAGATACAGTTAACCTGCAAAGAAAACATAAGCCAACTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGATTTTTGACTTAGGATCTAATAAAATACTTCACTGAAGTACAAGTAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGCAAAGAAAACATAAGCCATCTACTGCTTGCTGTTGACTCTTGCATTTGAAAGTCAATAACCCTGTAAACCCTTTATCCCAGCCATGCAAGCCCATCAAGTATGAGTGGGTGGTCATGCATGTAGCATTGTTTGGGTGAACTAAATGAAGAATATCTAATATTTAGGTCTGTCAAGAAATCTAATCAAAATAATTCAGATTGGTTTGACCTAGACAGAGCTGTTCCAGCTTCTTGCACAATGAATGGTATCATTTATTAAAATCATGATTTTTGACTTAGGATCTAATAAAATACTTCACTGAAGTACAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)