Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3378183-IMAGp.5                14 PI      85       1447     1764                hypothetical protein LOC414596 [Xenopus laevis]
     2   0.0    0Xl3.1-xl341h23.5                            8 PI      94          1      743                E2F transcription factor 4, p107/p130-binding [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012773172 Xl3.1-XL215c14.3 - 21 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                     2     2     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     6     7     6     6     6     6     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     5     4     6     6     7     6     7     5     8     5     8     5     8     6     9     7    10     7    10     8    10     7    10     7    10     8    10     8    10     8    10     9    10    10    10     9    10     9    10    10    11    10    11    10    11     9    11     9    11     9    11    10    11     9    10     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     8    10    10    10    10    10    11    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     7     9     5     8     5     6     4     4     4     4     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
  3   1   2       bld Tad2                            IMAGE:6881321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAACCGGGAATTCCCTAAAGAAAAGGGTTTCGGAATTTTTTGGATCAAACCAAAGGAATGTTTCAAGTTCAGACTTACTGGGAAGAATTAAGTCCTCAGAAGTTTTTGCTCTTTGGTTCAGACTCTCCCTTCATCCCGGGGGATCACGATTATGTCTATAATTTGGATGAAAGTGAAGGAGTTTGTGATCTTTTCGATGTACCCATCAACCTCTGATATTTTGAAACTCGGCTATGCGCCTCTTTGTGAATAAGAACTTTTTTTGTTGTCTTTTATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACCATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACCATGAACNTATTAGTAATTTT
  5   1   2       bld Emb1                            IMAGE:3403018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTGATCAAACAAAGGAATGTATCACTTCAGACTTACTGGAAGAATTAATGTCCTCAGAAGTTTTTGCTCCTCTGCTCAGACTCTCCCCTCCTCCCGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGATCTCTTCGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAACtttttttgttgtcttttatgaaaaaatgtttctatttttGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTAT
  5   1   2       bld Ov1       in                    IMAGE:5049307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCCACGCGTCCGGTATCACTTCAGACTTACTGGAAGAATTAATGTCCTCAGAAGTTTTTGCTCCTCTGCTCAGACTCTCCCCTCCTCCCGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGATCTCTTCGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAActttttttgttgtcttttatgaaaaaatgtttctatttttgGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACCATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATG
  5   1   2      seed Ov1                    IMAGE:5049307-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTATCACTTCAGACTTACTGGAAGAATTAATGTCCTCAGAAGTTTTTGCTCCTCTGCTCAGACTCTCCCCTCCTCCCGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGATCTCTTCGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAActttttttgttgtcttttatgaaaaaatgtttctatttttgGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACCATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAA
  3   1   2       bld Em10      in                    IMAGE:7981886.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAATCTATTTCTCGAGAAGTTTTTGCTCCTTGGTCAGACTTCTCCCTCCTCCCGGTGATCACGACTATGTCTATTATTAGATGAAAGTGAAGAGTTTGTGATCTCTCGGATGTACCCATCAACTCTGATATTTTGAAACTCGGCTTTGCGCCTCTTTGTGAATTAAGAACTTTTTTTGTTGTCTTTTATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACCATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTC
  3   1   2       bld Neu7      in                         XL011j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGACTCTCCCCCTCCTCCCGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGATCTCTTCGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAACTTTTTTTGTTGTCTTTTATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACTATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACANAACTATTTGAATTTTTNTTTGTACAAAATAAATCCA
  3   1   2       bld Ga12      in                         XL215c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGTGATCACGACTATGTCTATAATTTAGATGAAAGTGAAGGAGTTTGTGATCTCTTCGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAACTTTTTTTGTTGTCTTTTATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACTATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTGTACAAAATAAATCCATATTTGGCAGTAGCATT
  3   1   2       bld Neu7      out                        XL043a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATGTACCCATCAACCTCTGATATTTTGAACTCGGCTTTGCGCCTCTTTGTGAATAAGAACTTTTTTTGTTGTCTTTTATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAAT
  3   1   2       bld Neu7      in                         XL042m09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGAAAAAATGTTTCTATTTTTGGATATCCGCGTGAGTTGTTACAGAATCCATACCAGAGACATCTACAATGCAAAAAACACACCTACTCCTCTCAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACTATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTATTTTTTGTTTT
  3   1   2       bld Ov1       in                    IMAGE:5049307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATGTAATGAAAATCGTCTTATAGCCTTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTCGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGCTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTTGATTCTACACAGTTATATAGAAGGTGTACAGCACCATCCACCATAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAACTAGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTGTACAAAATAAATCCATATTTGGCAGTAGCATTTTAGGGATG
  3   1   2       bld Ov1       in                    IMAGE:5073941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCCATCCCTGTGATAAGAGGACTGCTTGGCAAACCCTTGGTAGAGGTTGTCGGTATTGTTCCAGCTTTATTAAGTCCATTATGTCATCTTACAGAAGCATTTTACAAATTTTAAGCACTTAACATTTTTGTTGCAGTACATAACAGTATTTGGGCTTTTTATCCATAATTAGAAGGTCTGGATTTTCCCCAGTTATATAGAAGGTGTCCAGCCCCATCCCCCATAAATTAATGGTTTTCCATGCAGTACCAGTAAAGAATAAGCTTGGTTGTCTTTTGTTATGTTCGGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTTTAGTTAATATCCCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTTTACATACATTTGCTGCGCCACATGAACTATTGGTAATTTTTTGTTTTGTACAAAATAA
  5   1   2       bld Egg1                               PBX0023H11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGGAAACTAATGGTTTTCCATGCAGTAACAGTAAAGAATAAGCTTGGTTGTCTTTTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTGTACAAAATAAATCCATATTTGGCAGTAGCATTTTAGGGATGTAAAAACAAACACCCAGAGCTGCTGTGTGGTTTTATTTGTTGTGGAGAAAGTGGTGAGATACAACACAAAAGCTATTCAGTGCATTATTATAGTGCAAATGATATGCCCTGCAATGATTGCTGGAACTGGAAATAGATTATACATAGGAACATAGTAAGTAAGGTTGAAAAAAGACATGTCCATCAAGTTCAACCTTttattattattattattTGCCTCAGAGGGGAAAAAATTCCTTCCTGACTCCAAGATGGCAATCGGACTAGTCCCTGGATCAACTTGTACTATGAGCTATCTCCCATAACCCTGTGTATATATTTTATAAAGAATATTATAGGGCAAATAGTTAACCTATTCCTAACAAGTCACTTCCAAGAGAGAATATGCCTTAGGCCTGACATCTTTCTTTACACAGTGCTTCCATACAACTTTCCATTTCTCATATAATTGGTGACATGA
  3   1   2       bld Egg1                               PBX0004G07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTAAAGAATAAGCTTGGTTGTCTTCTGCTATGCTCTGGCCTCACTCACTGCCAAATCACTGCCAGTCACTGTCTAGCTAATATACCTAAATGAAAGAATATGTTGAAATGAAATTATTTTTCTACATACATTTGCTGCGCCACATGAACTATTTGTAATTTTTTGTTTTGTACAAAATAAATCCATATTTGGCAGTAGCATTTTAGGGATGTAAAAAAAAAAAAAAAAAAAGATTC

In case of problems mail me! (