Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL201l03.3                            9 END     6          50       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5571899.5                       5 PI      94         69      633                transcription factor xGATA-5a [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012773310 Xl3.1-IMAGE:3748361-IMAGp.5 - 12 ESTs
                                                                       ........-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3748361-IMAGp.5                                                                                                             TCAGTCGCAGGATCTTACTCCGACAGTGTTGGATCAAGCCCCTCCAAAGGATTCCCAGCAGAACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAGGCCATTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAACGGCATCAACAGACCACTAATCAAGCCACAGAAAAGACTGTCTTCCTCCCGGAGAGCTGGCCTTTGCTGTACAAACTGTCACACCAGCACCACAACCCTCTGGAGGCGCAACTCAGAAGGAGAGCCGGTGTGTAACGCG
                                                  Xl3.1-CHK-1012694259                                                                                                                   GCAGGATCTTACTCCGACAGTGTTGGATCAAGCCCCTCCAAAGGATTCCCAGCAGAACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAGGCCATTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAACGGCATCAACAGACCACTAATCAAGCCACAGAAAAGACTGTCTTCCTCCCGGAGAGCTGGCCTTTGCTGTACAAACTGTCACACCAGCACCACAACCCTCTGGAGGCGCAACTCAGAAGGAGAGCCGGTGTGTAACGCGTGTGGA
                                                      consensus depths                                                                                                                  2     2     3     3     3     3     3     4     4     5     5     7     7     7     7     7     7     7     8    10    10    10     9    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     9    11     9    11     9    10     8     9     9    10     9    10     8    10     9    10     9    10     8    10     9    10     7     8     6     8     6     8     5     7     5     7     4     6     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2
                                               BLH ATG     141     563                                                                                                             
                                               BLH MIN     141     119                                                                                                             
                                               BLH OVR     141    1234                                                                                                             
                                               EST CLI      39       1                                                                                                             
                                               ORF LNG     141      53                                                                                                             
  5   1   2       bld Ga12 5g3  out                        XL195b02.5p GGCCGCTCCTTGCTGCACAGTCGCCAATCCGCTCTCACAGGCGTCACGTGACCCTGCCCATACAATTGCCAGCAGCGGGCCCTTGCAGTTATTTCCAAAAGAGAGTGCTCAGTCGCAGGATCTTACTCCGACAGTGTTGGATCAAGCCCCTCCAAAGGATTCCCAGCAGGACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGG
  5   1   2       bld Emb4 5g                         IMAGE:5571176.5p                                                                                                             TCAGTCGCAGGATCTTACTCCGACAGTGTTGGATCAAGCCCCTCCAAAGGATTCCCAGCAGAACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGTGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGATGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTTACCGGGGAGGATATCCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCCGGGGCTATGTCGACCCCTTCTGTGGAAAAAGAAATGGGAACAGGCCATTACCTGTGCCAATGCCCGGCGGGCTGTAACCATAAAATGAACGGGCTTCAAACAGAACCACTAATTCAGCCCAAAGGAAAAAGACTGGTCTTCCCTCCCCGAAAAACTTGGCCCTTTTGCTGTACACAACTGGCCAAACCCACCACCCACAACCCC
  5   1   2      seed Gas7 5g                IMAGE:3748361-IMAGp.IMAGp                                                                                                               CGTCGCAGGATCTTACTCCGACAGTGTTGGATCAAGCCCCTCCAAAGGATTCCCAGCAGAACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCCA
  5   1   2       bld Em10 5g                         IMAGE:8321015.5p                                                                                                                                           CGAACAAGTCGCTCTAGAGGATTTCCAGCCGGAGCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCCGGAGCTGTGAGGTTTGTAGCACCGGATCATGTACCCCAGCCTGGCCCTCACTGTCAACCATGCCCAGCCGGCCTACTCCCACGACACCCCAAACTTTCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCCCTGCCCTACCTTCAGAGCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCATCCGGGATGGGCACAGACTGCCGAGAGCCACGCGTTCAATGCCAGCAGCCCCCACACGCCAACCGGATTCTCTTACTCACACAGCCCCCCAGTGGGCAACAGCAGCGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCGGTGCCAGGGACCATTATGGCAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTATTCCTATGTGGGCGCGGATATGCTCCCTTCTTGGGCTGCTGGACACTTTGAGGGAAGCATGTTGCACAGCCTGCAGGGGAAACAATCCTTATCGGGTCGGAGATCCAACCTGGAGTTCCTAAAACAATTTCCTGGAGATGGAAGAAAAG
  5   1   2       bld Gas5 5g                         IMAGE:3748361.5p                                                                                                                                                    CCCTGCAAAGGATTCCCACCATAACCCACGCTCATCCAATCTCTCGGCGGAGTCGGTGGTACGAACGCTCATCAAGAGCTGTGAGGTTTGTAACGGAAGATCATGTACCCCAGCCTGCCCCTCACTGACAACCATGCCCAGCCGGCCTACTCTCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCACTGATCATGTGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCAGATATGCCCCCTTCTTGGGCAACTGGACACTTTTGAGGGAGCATGTTGCACAGTCTGCATGGGAGACAGCCCCTTACCGGGAGGATATCC
  5   1   2       bld Ga12 5g3  out                        XL164p20.5p                                                                                                                                                               GATTCCAGCAGGACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCA
  5   1   2       bld Ga12 5g3  out                        XL204m24.5p                                                                                                                                                                  CCCAGCAGAACCCACGCTCAGCCAATCTCTCGTCGGAGTCGCTGGTAGGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCA
  5   1   2       bld Neu1 5g3  out                    Neu1-32E11-1.5p                                                                                                                                                                                                                 GGAAGGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAA
  5   1   2       bld Neu7 5g3  out                        XL016d20.5p                                                                                                                                                                                                                     GCTCAGCAGGNAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCTAGTGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAGGCCATTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAACGGC
  5   1   2       bld FaBN 5g                         IMAGE:8079324.5p                                                                                                                                                                                                                     GGCTCAGCAGGAGCTGTGAGGTTTGTAGCGGAGGATCATGTACCCCAGCCTGGCCCTCACTGCCAACCATGCCCAGCCGGCCTACTCCCATGACACCCCAAACTTCCTGCACTCCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAAGCCATTACCTGTGCAAT
  5   1   2       bld Em10      out                   IMAGE:7982989.5p                                                                                                                                                                                                                                                                                                                                      CCACGGGCAGCCCCCCGGTCTATGTGCCCACCAGCAGGATGCCAGCCATGCTCCAGTCTCTGCCCTACCTTCAGACCTGCGACACTGCCCACCAGGGACACCATCTGGCCAACCACCCAGGATGGGCACAGACTGCCAACGAGAGCCACGCGTTCAATGCCAGTAGCCCCCACACACCCAGCGGATTCTCTTACTCGCACAGCCCCCCAGTGGGCAACAGCAGTGCCAGGGACGGTGGCTACCAGAGTCCCCTGATCATGGGTGGCAGTGCCAGGGACCAGTATGGAAATACACTGGTGAGAACTGGCTCTTACCCCAGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAGGCCATTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAACGGCATCAACAGACCACTAATCAAGCCACAGAAAAGACTGTCTTCCTCCCGGAGAGCTGGCCTTTGCTGTACAAACTGTCACACCAGCACCACAACCCTCTGGAGGCGCAACTCAGAAGGAGAGCCGGTGTGTAACGCGTGTGGATTG
  5   1   2       bld Em10                            IMAGE:8322106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTCTTACCCCGCCCTTACTCCTATGTGGGCGCGGATATGCCCCCTTCTTGGGCAACTGGACACTTTGAGGGGAGCATGTTGCACAGTCTGCAGGGGAGACAGCCCTTACCGGGGAGGATATCCAGCTTGGAGTTCCTAGAAGAGTTTCATGGAGAGGGAAGAGAATGTGTGAACTGCGGGGCTATGTCGACCCCTCTGTGGAGAAGAGATGGAACAGGCCATTACCTGTGCAATGCCTGCGGGCTGTACCATAAAATGAACGGCATCAACAGACCACTAATCAAGCCACAGAAAAGACTGTCTTCCTCCCGGAGAGCTGGCCTTTGCTGTACAAACTGTCACACCAGCACCACAACCCTCTGGAGGCGCAACTCAGAAGGAGAGCCGGTGTGTAACGCGTGTGGATTGTACATGAAACTACACGGGGTTCCCCGTCCTCTGGCCATgaagaaagaaagtattcagacccgaaaaagaaagcccaaaaatatcggcaaaggaaagACTTCCACAGGCTCCTCAACATCGGCCAACAACTCCCCGTCTTCAGTTACAAATACCGACCCCACGCCTGTGTTAAAAACCGAACCCAACATCACATCCCACTATCCAGGCCAGGCAATCGTACCAGTCTCCCAGGGCCAGAGTCAAACAGATGATCTGGTCAACGGGTCCCACGAGCTAAATACATCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)