Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL474d20ex.5                         23 PI      74        557     1398                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012773348 Xl3.1-IMAGE:8329620.5 - 24 ESTs
                                                                       ......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8329620.5                                                                                                                                                   AAAACGCAAGAGGAGAAGGAAGCAGCAGCTGCTTTAAAAATTAAGAAGAAAGAAGAAGAAGAACAGATGCGTTGGAGATGGTGGGAGGAAGAAAAGTATGAAGATGGCATAAAGTGGAAGTTTCTGGAACATAAAGGCCCCTTTTTTGCTCCACCCTATGAGCCGTTGCAGGAGAATGTGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACAAAGGAAAAATGGAGGAAAAGAAAAATAAATCAAAAGAAGATAAACTAAAAATCAAAGAGGAAAATGAAAAACTTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGCCTCCAGCACTATTCCGTGGACGAGGAGACCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTACATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGGCAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGCCAAAGAAAAAGACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATAAAAAAAAAAGTCACTTTGTCATAATTTTAAATAATTCCCATGAATT
                                                  Xl3.1-CHK-1012689000                                                                                                                                                         CAAGAGGAGAAGGAAGCAGCAGCTGCTTTAAAAATTAAGAAGAAAGAAGAAGAAGAACAGATGCGTTGGAGATGGTGGGAGGAAGAAAAGTATGAAGATGGCATAAAGTGGAAGTTTCTGGAACATAAAGGCCCCTTTTTTGCTCCACCCTATGAGCCGTTGCAGGAGAATGTGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACAAAGGAAAAATGGAGGAAAAGAAAAATAAATCAAAAGAAGATAAACTAAAAATCAAAGAGGAAAATGAAAAACTTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGCCTCCAGCACTATTCCGTGGACGAGGAGACCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTACATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGGCAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGCCAAAGAAAAAGACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATAAAAAAAAAAGTCACTTTGTCATxxTxxxxAAxxxTTCCCA
                                                      consensus depths                                                                                                                                                        2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     5     4     5     4     5     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     4     4     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     5     6     5     5     5     5     5     5     5     5     5     5     5     7     5     7     5     7     5     8     4     8     4     8     4     8     4     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7     9     7     9     7     9     8     9     8     9     8     9     8     9     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    11    10    11    10    11    10    11     9    10    10    11    11    12    11    12    11    12    11    12    12    13    12    13     9    13     9    13     9    13     8    12     8    12     8    12     9    13     9    13     9    13     9    13     9    13     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    11     8    11     8    10     8    10     7    10     7     9     7     9     7     9     7     9     6     8     6     7     6     7     5     7     5     7     4     7     4     7     4     6     5     6     3     6     2     4     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCAGCTTATCAATGAAGTAGAGAGCCACAGCCCGCTGACGTACTTTCATTTCCTTGGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---AT-------
  5   1   2       bld Oo1                             IMAGE:5084839.5p AATTGTCAAAGTCAAAAAAAGTGAAACTAGAGGAAGATGCAAATGAGACGgaaacagaaactaaaccaaaaaagaagaaaaaaattaaaacggaggaaggtaagcaaaaacccaagaaggaagaaagtgatagaaagccaaaaaagaaaacgcaagaggagaaggaagcagcagctgctttaaaaattaagaagaaagaagaagaagaacagatgcgttggagatggtgggaggaagaaaagtatgaagaTGGCATAAAGTGGAAGTTTCTGGAACATAAAGGCCCCTTTTTTGCTCCACCCTATGAGCCGTTGCAGGAGAATGTGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACaaaggaaaaatggaggaaaagaaaaataaatcaaaagaagataaactaaaaatcaaagaggaaaaTGAAAAACTTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGTCTCCTCGTCCACGGAATAGTGCTGGAGGCCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCANAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGGTTACCTGGNNTGGCATCATGGACAGAAAATGTACAGGGNATCAGTGGAAGTACATAATGGCTCAAATGCCAAACTCCCAAGCTG
  3   1   2       bld Ga18      in                       xlk70i12ex.3p                                                                                                                                                   AAAACGCAAGAGGAGAAGGAAGCAGCAGCTGCTTTAAAAATTAAGAAGAAAGAAGAAGAAGAACAGATGCGTTGGAGATGGTGGGAGGAAGAAAAGTATGAAGATGGCATAAAGTGGAAGTTTCTGGAACATAAAGGCCCCTTTTTTGCTCCACCCTATGAGCCGTTGCAGGAGAATGTGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACAAAGGAAAAATNGNNAAAAGAA
  5   1   2       bld Ga18      in                       xlk70i12ex.5p                                                                                                                                                    AAAACGCAAGAGGAGAAGGAAGNAGNNNNNNTTTAAAAATTaagaagaaagaagaagaagaaCAGATGCGTTGGAGATGGTGGGAGGAAGAAAAGTATGAAGATGGCATAAAGTGGAAGTTTCTGGAACATAAAGGCCCCTTTTTTGCTCCACCCTATGAGCCGTTGCAGGAGAATGTGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACaaaggaaaaatggaggaaaagaaaaataaatcaaaagaagataaactaaaaaaaaaa
  5   1   2       bld Oo1                             IMAGE:6642256.5p                                                                                                                                                                                                                                                                                                                                     TGAAACTTTATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACaaaggaaaaatggaggaaaagaaaaataaatcaaaagaagataaactaaaaatcaaagaggaaaatgaaaaaCCTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGCCTCCAGCACTATTCCGTGGACGAGGAGACCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTATATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGGAAAATGAAAGTACGTCAGCGGGGCTGTGGGCTCTCTACTTCATTGATAAAGCTGGCATTGAGAGCAGGTAATGAAAAGGGAAGAAGGGAGAATCTTGCAGATACAGNTGGGGTTGGCTGTCTCCCTAAGAGTGGAGCCACATAAAAGCTTTTACCCAGAAACTTCGATGGNAGGAGAAAGCATGTTG
  5   1   2       bld Egg3      in                    IMAGE:3378002.5p                                                                                                                                                                                                                                                                                                                                             ATTATGACGGTAAACCTTTATCATTAAGTCTACAAGCAGAAGAAGTAGCAAGTTTCTTTGCAAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTACaaaggaaaaatggaggaaaagaaaaataaatcaaaagaagataaactaaaaatcaaagaggaaaatgaaaaaCTTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGCCTCCAGCACTATTCCGTGGACGAGGAGACCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCT
  5   1   2       bld Oo1                             IMAGE:5083683.5p                                                                                                                                                                                                                                                                                                                                                                                              CAAGTTTCTTTGCAAAAATGTTGGACCATGAATATACAACCAAGGAGATCTTTCGCAATAACTTCTTCGTGGATTGGAGAAAGGAGATGACACTTGAAGAAAAGATGGTGATTACTGACCTGGACAAATGCGATTTTACTGAAATGTTTACTTACTAcaaaggaaaaatggaggaaaagaaaaataaatcaaaagaagataaactaaaaatcaaagaggaaaatGAAAAACTTTTGGAAGAGTATGGTTACTGTGCCATGGATCACCACCGGGAGAAAATTGGCAATTTCAAGATTGAGCCTCCAGCACTATTCCGTGGACGAGGAGACCACCCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTACATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGGTGGTTGAGTTTGACTTCCCTGGGTAAGACTCTATTCGATACTATAACAAAGTTCCTGGTGGGAAAGCAGGTCC
  5   1   2       bld Egg1                               PBX0116C07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAAGCAGGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCAAAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTACATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAA
  5   1   2       bld Egg1                               PBX0101D08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGATGTTGAAGAAGCGGATACTCCCTGAAGATATTATCATCAATTGTAGCTTAGATTCAAAAATCCCTGAGCCACCTCCTGGGCACAAATGGAAAGAGGTGCGCCATGACAATACTGTTACCTGGTTGGCATCATGGACAGAAAATGTACAGGGATCAGTGAAGTACATAATGCTCAATGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACAC
  5   1   2       bld Egg1                               PBX0151F01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGAGGGCAAACTCCAAGCTGAAGGGAGAAAAAGACTGGGAAAAGTATGAAATTGCCAGAAAGCTGAAACATCACGCTGAAAAAATTAGAAAGACGTATCGGGAAAATTTCAAATCCAAGGAAATGAAAGTACGTCAGCGGGCTGTGGCTCTCTACTTCATTGATAAGCTGGCATTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGAT
  5   1   2       bld Ov1                    IMAGE:6316851-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGTAATGAAAAGGAAGAAGGAGAATCTGCTCTCAATGCCAGCTTATCAATGAAGTAGAGAGCCACAGCCCGCTGACGTACTTTCATTTCCTTGGATTTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGgcaaagaaagagctgaaagaagccaaaaaaagaagccaaagaaaaagACAGTGAGAAGCTCAATAA
  5   1   2       bld Ov1                             IMAGE:6316851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGTAATGAAAAGGAAGAAGGAGAATCTGCTCTCAATGCCAGCTTATCAATGAAGTAGAGAGCCACAGCCCGCTGACGTACTTTCATTTCCTTGGATTTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGgcaaagaaagagctgaaagaagccaaaaaaagaagccaaagaaaaagACAGTGAGAAGCTCAATAAGGGTTGGAGAAAGGCACGAAAAGGGCAGCGCAGAGAAACAAAGGAACAACCCATGAAGAATGGGAGGTGCAAGGCAACTTGACCCGCAAAGAGGAATTAACCGGATTTGCCTTGGAGGCACCTCCCCAAATTAAAACTTATCTGGGATCCCCGGGGATCTCTCTGGGGGCCCTGGTTGCCCAGAAACATGGACACTGTTTGGCACTGGGaaaaaaaaTCTTA
  5   1   2       bld Emb4                   IMAGE:5570955-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAATCGCCAGCTTATCAATGAAGTAGAGAGCCACAGCCCGCTGACGTACTTTCATTTCCTTGGATTTGAGAGCAGGTAATGAAAAGGAAGAAGGAGAATCTGCAGATACAGTGGGTTGCTGCTCCCTAAGAGTGGAGCACATAAAGCTTTACCCAGAACTCGATGGAGAGAAGCATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGgcaaagaaagagctgaaagaagccaaaaaaagcagccaaagaaaaaGACAGTGAGAAGCTCAATAA
  5   1   2       bld Egg3                            IMAGE:6324690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGGGTAAAGCTTTACCCTCAACTCGATGGAGAGAACATGTGGTTGAGTTTGACTTCCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGgcaaagaaagagctgaaagaagccaaaaaagaagccaaagaaaaagaCAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCNGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTAAATTGGAAAGTTCCATTGCTTCCTTGACAAAAGTCATGAGGGTTATTTTTA
  5   1   2      seed Ov1                             IMAGE:8329620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGGTAAAGACTCTATTCGATACTATAACAAAGTTCCTGTGGAAAAGCAGGTCTTTAAAAACCTCCAGCTGTTTATGGAGAACAAAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGgcaaagaaagagctgaaagaagccaaaaaagaagccaaagaaaaagaCAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGAttttatttttttAAG
  5   1   2       bld Ooc1      in                      xlnoc002p16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAGGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGaagaaagagcagattttactggcaaagaaagagctgaaagaagccaaaaaagaagtcaaagaaaaagaCAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGAT
  5   1   2       bld Egg1                               PBX0052E04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGAGGGAGATGATCTATTTGACAGGCTGAATACCCCTTTGCTTAACAAGCACCTACAGTCATTGATGGAAGGACTGACTGCAAAGGTTTTCAGGACATACAACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGTGAAGAAAGAGCAGATTTTACTGacaaagaaagagctgaaagaagccaaaaaagaagccaaagaaaaagACAGTGAGAAGCTCAATAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTNCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGAC
  3   1   2       bld Oo1                             IMAGE:5078418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACGCATCGATCACACTGCAGCAGCAGCTCCAGGAGCTCACAGACCCTGAAGAAAGCATCCCTGCAAAGATCCTCTCATATAATAGAGCCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGTGAAGAAAGAGCAGATTTTACTGACAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGCCAAAGAAAAAGACAGTGAGAAGCTCAATAAGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATAAAAAAAAAAGTCACTTTGTCATTTTAAATAAATTTTCCCATGAATTACATACATTTTGCAGTAAAAAAA
  3   1   2       bld Egg3                            IMAGE:3379309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTCATATAATAGAGCAACAGAGCGGTTGCAATTCTGTCAACCATCAGCGGGCACCACGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGGCAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGCCAAAGAAAAAGACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATAAAAAAAAAAGTCACTTTGTCATTTTAAAT
  5   1   2       bld Egg1                               PBX0063B04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAACAGAGCGGTTGCAATTCTGTGCAACCATCAGCGGGCACCACCGAAAACCTTTGATCAATCTATGGCAAATCTTAAATCTAAGATTGATGTGAAGAAAGAGCAGATTTTACTGacaaagaaagagctgaaagaagccaaaaaagaagccaaagaaaaagaCAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTNTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGGCT
  3   1   2       bld Egg4                            IMAGE:3743591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTATGGCAAATCTTAAATCTAAGATTGATGCGAAGAAAGAGCAGATTTTACTGGCAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGCCAAAGAAAAAGACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATACATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATATTATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGTAAAGATCATTGCTTCTTGACAAAACTGTCATGAGATTTATTTTAATGCACTTCTTTATAAAAAAAAAGTCACTTTCTGTAATTTTAAATAAATTTTTCCCATGAATTACATACATTTTGCAGTAAAA
  5   1   2       bld Egg1                               PBX0152A04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGAGGCTTAAATCTAAGATTGATGTGAAGAAAGAGCAGATTTTACTGacaaagaaagagctgaaagaagccaaaaaagaagccaaagaaaaagACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATaaaaaaaaaaGTCACTTTGTCATTTTAAATAAATTTTCCCATGAATTACANANaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ooc1      in                      xlnoc002p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGAAAGAGCTGAAAGAAGCCAAAAAAGAAGTCAAAGAAAAAGACAGTGAGAAGCTCAATAAGGTTGTAGAAAGCAAGAAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATACATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATATTATGCTGTCTGGTACAAATACATGTTAATAATATTTTTTATATTGTAAAGATCATTGCTTCTTGACAAAACTGTCATGAGATTTATTTGAATGCACTTCTTTATAAAAAAAAGTCACTTTCTGTAATTTTAAATAAATTTTCCCATGAATTACAAAA
  3   1   2       bld Egg3      in                    IMAGE:3378002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGTTGTAGACAGCAAACAAAGGGCAGTGCAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATGCATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATGATATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGGAAAGTTCATTGCTTCTTGACAAAAGTCATGAGGTTTATTTTAATGCACTTCTCTATAAAAAAAAAAGTCACTTTGTCATTTT
  5   1   2       bld Egg1                               PBX0020F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGAACAGAGGAACAACTCATGAGAATGGAGGTGCAGGCAACTGACCGAGAAGAGAATAAACAGATTGCCTTGAGCACCTCCAAACTAAACTATCTGGATCCCAGGATCTCTGTGGCCTGGTGCAAGAAATGGACTGTTGGACTGGAAAAAATCTACAACAAGACATACCGGGACAAATTTGCTTGGGCCATTGACATGACTGAAACAGATTTTATTTTTTAAATACATTTTCAAGTGCTGTTCGTTATTAAAAGCACTGATATTATGCTGTCTGGTACAAATACATGTTAATAATATTGTTTTTATATTGTAAAGATCATTGCTTCTTGACAAAACTGTCATGAGATTTATTTTAATGCACTTCTTTATaaaaaaaaaGTCACTTTCTGTAATTTTAAATAAATTTTCCCATGAATTACATaaaaaaaaaaaaaaaaaaaaaaaaaaGATTCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)