Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl315l15.3                           22 END     8          40       36                homeobox Iro protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012773546 Xl3.1-xl315l15.5 - 20 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                         6     7    10    10    10    12    10    13    10    16    10    17    12    17    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    12    18    14    18    14    17    14    17    14    17    14    17    14    17    13    17    11    17    12    17    12    17    11    16    11    16    10    16    10    16     9    15     9    15     9    14     8     9     8     8     8     8     8     8     8     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     5     5     5     5     5     5     5     5     4     4     2     3
                                               BLH ATG     324     180                    
                                               BLH MIN     324      43                    
                                               BLH MPR     324      43                    
                                               BLH OVR     324     320                    
                                               CDS MIN     324      43                    
                                               EST CLI     -12      15                    
                                               ORF LNG     324       4                    
                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 8e-021     XP_544403.2 PREDICTED: similar to Iroquois related homeobox 3 [Canis familiaris] ====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-037     NP_997068.1 iroquois homeobox protein 1, a isoform 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-049     NP_077313.3 iroquois homeobox protein 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-050     NP_034703.2 Iroquois related homeobox 1 [Mus musculus] ==============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Bt ==== 4e-050     XP_001251877.1 PREDICTED: similar to homeodomain protein IRXA1 [Bos taurus] =========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 1e-056     NP_001025509.1 iroquois homeobox protein 1 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 1e-066     AAT72003.1 iro1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 2e-067     NP_001081649.1 homeobox Iro protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl315l15.5                             TGA------------TAA------TAG---------------------TGA------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld DMZ                                  xl270d18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTGGGCATGTATGCCAGCCCGTACAGCGCCCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCANTATGAACTGAAAGACAATCCTGGTGTCCATCCAGCTACGTTTGCTGCGCACACTACTCCAGGCTATTACCCCTAT

In case of problems mail me! (