Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Sep 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl264a15.5                           29 END     11         61       37                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL468a02ex.3                         22 PI      86        184     1068                similar to Rac GTPase activating protein 1 [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:5156781.5                       5 PI      95          1      163                similar to Rac GTPase activating protein 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012773558 Xl3.1-xlk146m13ex.3 - 18 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk146m13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTCATGGAAGCAGCTGAAATGGCAAATGAAGAGCGCAGCATAGCAGCTATTTACCAAGCTGTAGATGGGTTGCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATGACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAATACTGCTAAATTAT
                                                  Xl3.1-CHK-1012690357                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAAGCAGCTGAAATGGCAAATGAAGAGCGCAGCATAGCAGCTATTTACCAAGCTGTAGATGGGTTGCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATGACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAATACTGCTAAATTATCAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     6     3     6     3     6     3     6     3     7     3     7     4     7     5     7     5     7     5     7     5     8     7     8     6     8     6     8     7     8     6     8     7     8     8     8     8     8     8     8     7     8     8     8     8     9     8     9     7     9     9    10     9    10     9    11     8    10     9    11     9    11     9    11     9    11     9    11     9    11    10    13     9    13     9    13    10    13    10    13    11    14    11    14    10    14    12    14    12    14    12    14    11    14    12    14    12    14    12    14    11    14    11    14    12    14    11    14    11    14    11    14    11    13    10    13    11    13    11    13    11    13    11    13    11    13    10    13     9    11     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    12     8    12     8    11     8    11     8    11     8    11     8    11     8    11     9    10     7    10     8    11     8    11     8    11     7    10     7    10     5     5     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C----
                                                                       ...PROTEIN --- Ce ---- 2e-008     NP_499845.1 GTPase activating protein like, CYtoKinesis defect CYK-4 (76.3 kD) (cyk-4)[Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-018     XP_319660.4 AGAP008912-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 5e-019     NP_610912.2 CG13345-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-040     XP_001196518.1 PREDICTED: similar to MGC53048 protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-062     NP_036155.1 Rac GTPase-activating protein 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 5e-064     NP_955925.1 Unknown (protein for MGC:77839) [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-068     XP_424490.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 7e-077     XP_543675.2 PREDICTED: similar to Rac GTPase activating protein 1 isoform 1 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 3e-078     XP_592496.2 PREDICTED: similar to Rac GTPase activating protein 1 isoform 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-078     NP_001119576.1 Rac GTPase activating protein 1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-095     CAJ83208.1 Rac GTPase activating protein 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 1e-103     NP_001084820.1 hypothetical protein LOC431862 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk146m13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------ATG------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------ATGATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------TAA------------ATG------------------------------------------------------TAA---------------------------------------TAG------------------------------TAA---------------------------------------------------------------------------------------ATG------------------------------------------TAA------------------------------------------------------------------------------TAG---------------------------------------TGA------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  3   1   2       bld Te2  5g3  out                   IMAGE:7390050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCCGTGTAGAGTCGGTTTCCAATTCAATCCAAATTAAGTCGGAAGCAGGGTTCTACGGGTGTNATTTNGGGGCGGCCAGAGATTTAGAAGTTCTCAGGGAGAGGTCTCTTTAATAAGTGATGATTCAGCGTTTGGGATCTTAAGATTTTTGGGAATCTCAGGAGCCCTTTNAANNTCCGCTCAATAAACTTCATGGAAGCAGCTGAATGGCAATGAAGGCNNCNGCATAGCAGCTATTACCAAGCTGTAGAGGGTCCCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCACAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTAAACACTTAATGCTTTACGAAGGAATAAAGATTTGAAACCC
  5   1   2       bld Gas5      in                    IMAGE:3750596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGCTTGTATCGAATTTCTGGCTGTGACCGCACAGTGAAGGATCTTAAGGAAAAGTTCCTCAGAGGAAAGAGTGTTCCTCTTCTAAGTAAGGTGGATGATATTCATGCGGTTTGTGGATTCCTTAAGGATTTTCTGCGAAATCTCAAGGAGCCACTTCTCACATTCCGGCTCAATAAAACTTTCATGGAAGCAGCTGAAATGGCAAATGAAGAGCGCAGCATAGCAGCTATTTACCAAGCTGTAGATGGGTTGCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATT
  3   1   2      seed DMZ  5g3  out                        xl265a15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNTCNATAAAACTTTCATGGAAGCAGCTGAAATGGCAAATGAAGAGCGCAGCATAGCAGCTATTTACCAAGCTGTAGATGGGTTGCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATTACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGT
  3   1   2       bld Ga18      out                      xlk67l06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ANNAAACNTNCATGGNANCAGCTNANTGGNAATGNANNNNCANNATAGCAGCTATTTNCCNAGCTGTANATTGGNTTNCNNGNNNNNANNAGAGNNNNNNTNGCTTNCTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGNCTGTAAGATGGATGTGAGNANTCTGTCCAAGGTATTTGGCCCAACTCTTNNNGTCACGCAGTGTCGGANCCTGACCCCATGACAATCCTTCNAGATACNAGGCGACANCCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCANAATACTGGANNCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGNCTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAANCTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATTACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATCACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATNTTGTGTAANNC
  3   1   2       bld DMZ  5g3  out                        xl264a15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTTTCATGGAAGCAGCTGAAATGGCAAATGAAGAGCGCAGCATAGCAGCTATTTACCAAGCTGTAGATGGGTTGCCAGCAGCCAACAGAGACACTCTAGCTTACTTGATGATCCATCTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATTACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATGTAGAAGCTCGT
  3   1   2       bld Ga18      out                     xlk146m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTNANNAACTTNANNANCAGCTGNAANNGNAATGANGNNNCANNATAGCAGCTNTTTNCNANCTGTAGATGGGTNNCAGNAGCNNCAGAGACACTCTAGCTTACTTGATGATCCATCTTCNANGAGTNNCCNAGAGCCCAGACTGNAAGATGGATGTGANNAATCTGTCCAAGGTATTTGGNCCAACTCTTGTNGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACANCCTATGNTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGNCCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCGCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATGACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAANNC
  3   1   2       bld Ga18      out                      xlk65p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCATAGCAGCTNTTTNCNAGCTGTAGATGGGTNNCCAGNAGCCAACAGAGANNNTCTAGCTTACTTGATGATCCATCTTCNNGAGTGNCNAGAGCCCAGACTGTAAGATGGATGTGAGCAATCTGTCCNAGGTATTTGGCCCANCTCTTNTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACANCCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCANNNNNNAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATTACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATCACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTNTGNAANNC
  5  -1   2       bld Ga12                                 XL175i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCAAAGAGTGGCCCAGAGCCCAGACTGTAAGATGTATGTGAGCAATCTGTCCAAGGTATTTGGCCCAACTCTTGTTGGTCACGCAGTGTCGGATCCTGACCCCATGACAATCCTTCAAGATACAAGGCGACAACCTATGGTCCTTGAAAGGCTGCTGTCGTTACCTGCAGAATACTGGAACCAGTACATGATGGTAGAAAATATTGACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGC
  3   1   2       add Ga18      out                     xlk152k22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGNAANGCTGCTGTNNTTNCCTGCANANNACTGGNNCCAGTACATGATGGTAGAAAATANTGNNCCNAATCACATTATTGAAANNNNCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGNCCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCGTCTCTCAGAGGATGAAATCCACAATTAGCAAAANCACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGACCTGGAAGATGCAAGTCATACACTGCTCCTGGTGTCTACTAATCTACCCTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTNCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAACTGTTCTGGATTGTTTTATCACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGNCCCCCCCCATCTTTCTGTAAATATTTTTCCCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATTTTTGNCTTTTAACNGTTATGTTGT
  5  -1   2       bld Bla2                            IMAGE:7299400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTAGAAAGGATGAGTCATTGCGGGACACAAATTAGAAGAACTGCTGAGGGTGTCTGGATTGACATCTGTGAGATTGCCCATCCTATGAATCATGTTAGCACTCCCGATCTGAGCAGGTCGATGTAGACCTTATACTCAGAGCACATTCAATAAATCCTCATCAGTCCTCTCTCAGAGGAGAATCCACAATAGCAAAACACCCCAATGTTTGGAAGCAAAAGTAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATGACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCaaaaaaaaaaCCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAATACTGCTAAATTATCaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGTACCCAATCGCCTAAGAGAGCGGN
  3   1   2       bld Gas5      in                    IMAGE:3750596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCCCAATCACATTATTGAAAATTCCAATGTTTTTAGCACTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAGAACTCCATCATCCAGCTCCCTCTCTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTCTGCTGCCAGCCATTAAGAGTTTTATTACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATCACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAA
  3   1   2       bld DMZ       out                        xl333i19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGAAAATTCCAATGNTTTTTAGCNCTCCCCAGACTCCTGATGCCAGAGTCAGCATGTTAGGACCCCTTACTACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTNTNTCAGAGGATGAAATCCNCAATTAGCAAAAACNCCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGNCAAGGNAACTTTTTTGCCTCNCCTNTGNTAAAATAAAAGGCCTGGAAGATGCAAGTCATACNCTACTCCTGGNGTCTACTAATNTACNCTTTGCTTTTAAACNCTTAATGCNTTTTACTGAAGGGAATTATAAAACNTTGTACTGTATAGCAAGTNTGCTGCCAGCCNTTAAGAGTTTTATTACTGNGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTNTGGNTTGTTTTATGNCAAGGTNTGAATGTTTTCCNGTTTATATTGGNGNGAGCNGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCACCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTT
  3   1   2       bld Ga12 5g3  out                        XL165l04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTCCAGAGCAACAATTCAATAAAACTCCATCATCCAGCTCCCTNTTTCAGAGGATGAAATCCACAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTNTGNTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTNTACTAATNTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTNTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTNTAAAATNTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTTTGGATTGTTTTATGACAAGGTTTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAA
  3   1   2       bld Ga12 5g3  out                        XL168c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNGCAACAATTCAATAAAACTCCATNATCCAGGTCCCTTTTTCAGNGGNTGAAATCCCCAATTAGCAAAAACCCCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTTTGNTAAAATAAAAGGCCTGGAAGATGCAAGTCATACNCTACTCCTGGNGTTTANTAATTTACNCTTTGNTTTTAAACNCTTAATGCATTTTNCTGAAGGGAATTATAAAACNTTGTNCTGTATAGCAAGTTTGCTGCCAGCCATTAAGAGTTTTATTNCTGNGCATTTTTATTATTTTAGTCGGnTGTTTTAAAATTTTCATTGTAGAAGnTnGTTTTAAGTTTTTAATTGTTTTGGATTGTTTTATGNCAAGGTTTGAANGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATNCGGTTTGACATAAATGGAGTTGATCAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCACCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAAT
  3   1   2       bld Neu7 5g3  out                        XL027n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNCAATTAGCAAAAACACCCCAATGTTTGGAAGCAAAAGTAAATCCGCAAGCAGCATCCCTAGACAAGGAAACTTTTTTGCCTCACCTCTGCTAAAATAAAAGGCCTGGAAGATGCAAGTCATACACTACTCCTGGAGTCTACTAATCTACACTTTGCTTTTAAACACTTAATGCATTTTACTGAAGGGAATTATAAAACATTGTACTGTATAGCAAGTNTGCTGCCAGCCATTAAGAGTTTTATAACTGTGCATTTTTATTATTTTAGTCGGCTGTTCTAAAATCTTCATTGTAGAAGCTCGTTTTAAGTTTTTAATTGTTCTGGATTGTTTTATGACAAGGTCTGAATGTTTTCCAGTTTATATTGGAGTGAGCAGGTAAACAATACGGTTTGACATAAATGGAGTTGATCAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCATCTTTCTGTAAATATTT
  5   1   2       bld Ga18      in                       xlk75e17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGACATAAATGGAGTTGATCaaaaaaaaaaaaCCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCACCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAATACTGCTAAATTaaaaaaaaaa
  3   1   2       bld Ga18      in                       xlk75e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGACATAAATGGAGTTGATCAAAAAAAAAAAACCTGCTTATATCTCTCACTTTAGGACTTTTTGGGGAATAGACCCCCCACCTTTCTGTAAATATTTTTACCAAAAAAAGTTGAACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTA
  5   1   2       bld Ga15                               XL485d13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACATTGCAGTCAATCCAAAATGTTGTATTAAACAACATAATTCATGTTTGGATTTAACTGTTATGTTGTGTAATACTCTGTAAATACAATACTGCTAAATTATCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaCAAANANA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)