Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8822187.3.5                    45 END     5          38       11                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6878881.3                       7 END     1           7       14                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012773643 Xl3.1-IMAGE:6864237.5 - 13 ESTs
                                                                       ..-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6864237.5                                                                         CGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAAGAGAAGAGGCCTAATCTGTATACATGGAAAGAGTTTATGCAGCTGGGAAAAGACATTCCAGACTCTCAATTAGACCAGATCATTTCATCTCAGAAGCCCAACCAATGTTGCACCCTCATCTATACTTCCGGGACCACTGGGCAACCTAAAGGAGTCATGCTTAGTCATGATAATATCACTTGGACCGCAGCTGCAGCAGGAAAGACTGTG
                                                  Xl3.1-CHK-1012693126                                                                               ACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAAGAGAAGAGGCCTAATCTGTATACATGGAAAGAGTTTATGCAGCTGGGAAAAGACATTCCAGACTCTCAATTAGACCAGATCATTTCATCCCAGAAGCCCAACCAATGTTGCACCCTCATCTATACTTCCGGGACCACTGGGCAACCTAAAGGAGTCATGCTTAGTCATGATAATATCACTTGGACCGCAGCTGCAGCAGGAAAG
                                                      consensus depths                                                                              5     7     6     9     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     7    10     7    10     7    10     7    10     7    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    12    12    13    12    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    11    11     9    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     8     9     7     9     6     8     6     8     6     7     6     7     6     7     5     6     5     6     4     6     3     6     4     6     3     6     3     5     3     5     3     5     3     5     2     5     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3
                                                                   VAR                                                                                                                         AATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTT
                                                                   VAR                                                                                                                                                                                                                                                             ACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTC
                                               BLH ATG      27     198                                                                         
                                               BLH MIN      27     128                                                                         
                                               BLH MPR       0     128                                                                         
                                               BLH OVR      27     182                                                                         
                                               EST CLI     -10       3                                                                         
                                               ORF LNG      27      13                                                                         
                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 5e-014     XP_001195941.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-018     NP_501893.1 ligase fatty acid family member (4L76) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - ?? ---- 8e-040     XP_646546.1 hypothetical protein DDBDRAFT_0190808 [Dictyostelium discoideum AX4] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ag ---- 3e-051     XP_314697.3 AGAP008596-PA [Anopheles gambiae str. PEST] ---------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 6e-052     NP_524698.1 bubblegum CG4501-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Bt ---- 1e-073     NP_001019719.1 lipidosin [Bos taurus] ------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Mm ---- 8e-074     NP_444408.1 lipidosin; lipidosis-related protein lipidosin; bubblegum [Mus musculus] -------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-074     XP_001790634.1 PREDICTED: acyl-CoA synthetase bubblegum family member 2 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 4e-077     XP_533936.2 PREDICTED: similar to bubblegum related protein [Canis familiaris] ----=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 2e-077     NP_112186.3 bubblegum related protein [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 8e-096     NP_001012864.1 similar to MGC53673 protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PREDICTED - Dr ---- 8e-104     XP_686467.3 PREDICTED: hypothetical protein LOC335159 isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED = Xt ==== 6e-158     NP_001121441.1 hypothetical protein LOC100158533 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED = Xl ==== 0          NP_001079494.1 hypothetical protein LOC379181 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6864237.5                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Sp1  5g3  out                   IMAGE:4964786.5p tgtgtgtgtgtgtAGCAGGGAGGCTACTTGGTAAATACTGCGGAGGAGACAGCAGAACATCATAGTACCAAGATGCTGTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCAT
  5   1   2       bld Sp1  5g                         IMAGE:5511217.5p                         CCCACGCGTCCGGCGGAGGAGACAGCAGAACATCATAGTACCAAGATGCTGTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGNTGGTGGAGAATCAGAAACAACTTCAAAAATCCTTCAGGTTCANGATCAGCTGCCTCACCTTAAGCATCATC
  5   1   2       bld Egg1 5g                            PBX0070A04.5p                                   CACGAGGGCGAGTAGTGCAGTAGACATTCACCTGNGGAACTCGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAGATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATATCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCA
  5   1   2       bld Ov1  5g                         IMAGE:6317017.5p                                       GCGAGTAGTGCAGTAGACATTCACCTGGGGAACTCGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCGGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCCTGAAGGAGAAGAGGCCNTAATCGGTATACATGGAAAAGAGTTTTATGCCAGCCGG
  5   1   2       bld DMZ  5g3  out                        xl274o13.5p                                                               CTGGGGAACTCGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCNACATTATTGTGGTGG
  5   1   2      seed DMZ  5g3  out                        xl261n05.5p                                                               CTGGGGAACTCGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCNACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGG
  5   1   2       bld Emb1 5g                         IMAGE:6864237.5p                                                                        TCGCTTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAAGAGAAGAAGCCTAATCTGTATACATGGAAAGAGTTTATGCAGCTGGGGAAAGACATTTCAGACTCTCAATTAGACCAGATCATTTCATCTCAGGAAGCCCAAACAATGA
  5   1   2       bld Oo1                             IMAGE:6637961.5p                                                                                TTGACATTACAGTGTGAAACTGACATGGCTGCTGTGATTTCAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGTCTTCTGCTGACATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCAGTCAGCTGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGNGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACCTTCAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAGGAGAAGAAGGCTAATCTGTATACATGGAAAAGAGTTATGCACCTGGGAAAAAGACATTCCAGAACTCTCAAATAGAACCAGATCATTTTCATCTTCAGAAGACCCCAACCCAATGTTGGGCACCCNTCCATCCTAATACTTCTTGGGGAACCCCTGGGT
  5   1   2       bld Ga12 5g                              XL178k17.5p                                                                                   GACAGTGTGAAACTGACATGGCTGCTGTGATTTCAAATTCTTCTGGGACAGAGCTGTATGTGGATCCCACCAAAGCAATACCAGATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGATGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGC
  5   1   2       bld Tbd7      out                        XL076e08.5p                                                                                           ACATGGNCTGCTGTGNATTTCAAATTCTTCTGGGNACAGNANCTGTATGTGGNATCCCACCAAANCAATACCAGNATTTATGTATAAATGATGTAGTCCTATCCACTCCACCATGCTATGCTGAAGAAACTCTTGTGCAGCCTTCTGCTGAGATCAACACAAGTAACAGCAGCGAGNAAGCCCATAGTTCCTGAAATTTCCTCTTCAGATGTCATGGTCCATTCAGCTGTAGAAAACCTGCCAACATCTGACATGAAGCTGTGGACAGCACAGAGGGACAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACTGTAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATC
  5   1   2       bld Ga18      out                      xlk75b14ex.5p                                                                                                                                                                                                                                                                                                                                                                           AGAGGGNNAGTGCAGTGAAATTGCGACTGGAAGATTCGGATGTTGCCAGCTTGCCCCCTGTTACCATTCACCAGTTGTTCCAAGAGACNNAAATAAATACGGAGATTATGTGGCCCTTGCGTCTAAGCAGGGAGACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTNNNNTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAGGAGAAGAGGNCTAATCTGTATACATGGAAAGAGTTTATGCAGCTGGGAAAAGACATTCCAGACTCTCAATTAGACCAGATCATTTCATCTCAGAAGCCCAACCAATGTTGCACCCTCATCTATACTTCTGGGACCACTGGGCAACCTAAAGGTGTCATGCTTAGNCATGATAATATCACTTGGACCGCAGCAGCAGCAGGAAAGACTGTGCGACTAAGAGAGGNTACTGATCTGCAGGAAANTGTGGTTAGCTACCT
  5   1   2       bld Neu7                                 XL046j09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATGTGGCCCTTGCGTTTAAGCAGGGNAGNACCAGTGGCACAAAATGTCTTACAAGCAATATTATGAGCAGTGCAGAATAGCAGCCAAAGGTTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGGTTTAACTCTGCAGAATGGTTTATTGCGGATGTTGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACCACAAACTCTGCTGAGGCTTGTCATTATGTTGCACAGAACTGTGAAGCCAACATTATTGTGGTGGAGAATCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAAGCAATCATCCAGTACAAGGACGAGCTGAAGGAGAAGAGGCCTAATCTGTATACATGGAAAGAGTTTATGCAGCTGGGAAAAGACATTCCAGACTCTCAATTAGACCAGATCATTTCATCTCAGAAGCCCAACCAATGTTGCACCCTCATCTATACTTCTGGGACCACTGGGCAACCTAAAGGTGTCATGCTTAGCCATGATAATATCACTTGGACCGCAGCAGCAGCAGGAAAGACTGTGCGACT
  5   1   2       bld Eye1      out                   IMAGE:6948571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTCTCCGGATAAGCAGGGAGATCAGTGGCACATATTGACTTACAAACAATATTATGAGCAGTGCCGAAAAGCAGCCAAAGGGTTCATTAAGTTGGGTTTGGAAAGATACCATGGTGTGGGCATCCTGGGTTTTAACTCTGCGGAATGGTTTATTGCTGATGTGGGAGCTATTTTTGCTGGTGGCTTTGCTGTGGGCATCTATACAACAAATTCTGCTGAGGCTTGTCATTATGTGGCTCAAAACTGTGAAGCCAACATCATTGTGGTGGAGAACCAGAAACAACTTCAAAAAATCCTTCAGGTTCAGGATCAGCTGCCTCACCTTAAGGCAATCATCCAGTACAAGGACGAGCTGAAAGAGAAGAGGCCTAATCTGTATACATGGAATGAGTTCATGCAGCTGGGAAAAGACATTCCAGACTCTCAATTAGACCAGATCATTTCATCCCAGAAGCCCAACCAATGTTGCACCCTCATCTATACTTCCGGGACCACTGGGCAACCTAAAGGAGTCATGCTTAGTCATGATAATATCACTTGGACCGCAGCTGCAGCAGGAAAGACTGTGCGACTAAGAGAGGCTACTGATATGCAGGAAACTGTGGTTAGCTATCTGCCCCTTAGCCACATTGCAGCACAGATGATAGATATCTGGTTGACCATGAAGTATGGAGGAGCCACTTACTTTGCTCAGCCTGATGCACTGAAAGGCTCTTTAGCCAACACCTTGCGTGAGGTCAGGCCAACAGCCCTTTATGGGGTGTTTCCAAGAAGTGTGGGGAGAAAATGGCAGGAAGAAAAATGAAAAGCTTGTAAGGAAGCCAAAGTCATTCTACCAATTCAAAACGAAAAGGGTGGGCAAACTTTTGCGGCCCAAAAGGGAAGTTGGGGCGTTTAAAAGAACAACAATCTTGAAAAGGAAAAATGGAAATTGGGATCTAGCCCACCCCCCAATTCCCAATTGGAAAGTTAATCCACCCGNTGGGGCCaaaaaagaaaaattggggtgttttttccaaaaaaaaaGGTTCCCCGCACACAGAGGGCTGTCTTTGTGTGGAAACTATATAAAACCCGCATATGTGTTTACTAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)