Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3402349-IMAGp.5.5              27 END     1           5        3                forkhead box I1 [Xenopus tropicalis]
     2   2.0    0Xl3.1-xl267i20.3                            4 END     1           5       25                (no blast hit)
     3   1.5    0Xl3.1-XL211j19.3                            3 END     2          10       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-IMAGE:6632624.5                       7 PI      82          4      808                Unknown (protein for MGC:82909) [Xenopus laevis]
     5   0.0    0Xl3.1-xl267i20.3                            4 PI      95       1664     2055                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012773978 Xl3.1-xl287n02.3 - 19 ESTs
                                                                       .........0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl287n02.3          GCCATTTAGCGCTGCTGCTGCCTGGGATCCCGAGAGCGGAGCCGCTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGGCGCAACAATAGTTTCACTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAGAGTTGTTGAGATTAAGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGACGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACGTTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGATGAGGATAATTGTGCGGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGCGTCATGGCCTTGTTCTTGCCCTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGCTATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCCAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTCATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATATGTTCACTATAAAATAGAAATAT
                                                  Xl3.1-CHK-1012690271                TAGCGCTGCTGCTGCCTGGGATCCCGAGAGCGGAGCCGCTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGxxGxxxCAATAGxxxCxCTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAxAxxxGTTGAGAxxxxGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGACGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACGTTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGATGAGGATAATTGTGCGGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGCGTCATGGCCTTGTTCTTGCCCTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGCTATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCCAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTCATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAAC
                                                      consensus depths               2     2     2     2     2     2     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     7     8     8     9     8     9     8     9     8     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     4     3     5     3     4     2     4     3     4     3     4     3     3     3     3     3     3     4     4     4     5     4     5     4     5     4     6     3     6     3     6     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     8     8     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     8     7     8     7     7     6     7     6     7     7     7     7     7     5     6     3     4     3     4
                                               BLH ATG     429    1430          
                                               BLH MIN     429     140          
                                               BLH OVR     429    1017          
                                               ORF LNG     429      69          
  5   1   2       bld Ov1  5g                         IMAGE:8330561.5p TCCCATGACGCCATTTAGCGCTGCTGCTGCCTGGGATCCCGAGAGCGGAGCCGCTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGGCGCAATAGCTTCACCTCTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAGAGTTGAAATTAAGTTGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGACGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGACACAGTAATGAATATACAGAAGGGGCCCACGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAAT
  5   1   2       bld Em10 5g3  in                    IMAGE:7980550.5p          GCCATTTAGCGCTGCTGCTGCCTGGGATCCAGAGAGCGGAGCCGCTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGGCGCAATAGTTTCACCTCTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAGAGTTGAGATTAAGTTGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGAGGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCT
  5   1   2       bld Em10 5g                         IMAGE:8319302.5p                                           CGAGAGCGGAGCCGCTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGGCGCAATAGTTTCACCTCTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAGAGTTGAGATTAAGTTGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCATCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGAGGTCACGGATTTCAGATGTGTTCTCAGCCCACTGGGGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAAGCATCTTTG
  5   1   2       bld DMZ  5g3  in                         xl287n02.5p                                                         CTCAGTCACATCGCTAGTATCCGGCAGAGTGTAAGCTCCGCTGTCACACGCACTCAAGGCGCAATAGTTTCACCTCTGGGATTTCTCGCTACTTTCACGTTTCCTTCACTTTCTGCAAGAGTTGAGATTAAGTTGTATCGGGATTGTACTCTGTTTCCCTCACACTTCATTTAGTGGATACAAGGATCGCGCTGGATTGGGGGAGCCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGGGTTAACCCCCTATTGCCCAGTAACGGGAGCGGAGGTCACGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTG
  5   1   2       bld Ga12 5g3  out                        XL211j19.5p                                                                                                                                                                                                                                                                  GGCTGGAACCCTGACACATGTTTTCTGTGTCCCTTCCTATCGGGCTTGGAGAGCTCCTGCTGAAAGTTGCACGAAGCGTAGCCCAGAGTTAACCCCCTATTGCCCAGTAACGGGAGCGGACGTCACGCAGGATTTCAGATGTGTTCTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTC
  5   1   2       bld Oo1  5g                         IMAGE:6638496.5p                                                                                                                                                                                                                                                                                                                                                                                                         CACGCGTCCGCTCTGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACGTTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGATGAGGATAATTGTGCGGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGGGCGTCATGGGCCTTGNTTCTTGCCCCTGGTTTGGTGGNTGGTTACCTT
  5   1   2       bld Oo1  5g                IMAGE:6638496-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGCCCACTGGTGTGAAAACTCTTCAGAGTACTGATGGAGACGAGAGTACAAAATGGCAACGTATCCCAGCCTTTGCTCCCGGCTCGGCGTGACAATGGACGATTACACAGTGACACTGACCCACGGGAGATTTTAACACAGCAAGTTCATGTTTTGTCCTTGGAACAAATAAGAGCCATAAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACGTTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGT
  5   1   2       bld Ga18      out                     xlk102o06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCACGGGAAATCCTGACGCAACAAGTTCATGTTTTGTCTTTAGAACAAATAAGAGCCATAAGAAACACTAATGAATATACAGAAGGGCCCACAGTGGNTCCTCGCCCTGTGATTAAATCTGCTCCACGACCGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCAACCTTTTGTCAGGAGTCCACATCCACCAATGCATTCCTTGTCTCAGGCACCTTTGTCTCGATCAGTTGGNACAGTCGTTTCATCTTCTCGGAGCAATACAAGGACAAATAGCAGTTCTTCAGAGCAAAGGNTTCTTGCGCCACCATTTACATCTTCAGGATTGGTTGCAGACCGAATAATTAGAGTACAGCCCAAACCTGAGCTGAAATCTGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGGCTTACATTCATTAAGGTGTGAGGATTGTGGGAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGNCCAGGAAGNAGNTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTNTTCAAATGATGNCGAGNATNATTGTGCAGACAACCCATGTTCATGCAGNCAGNNCCACTGCTGCTCTCGANGGNCTGCTATCGG
  5   1   2       bld Lmb1                            IMAGE:8532871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGGCCGATTTGCAGAGCTCAGGCGATTCGTATTCGTCCCAGAAACAGTAATGAATATACAGAAGGGCCCACAGTGGCTCCCCGCCCTGTGATTAAATCTGCTCCACGACAGACTACCCAACAGAAAAATGAAAGAATACACGTGGTAAATGAGCAGCGACCTTTTGTCAGGACTCCACATGCACCAATGCATTCCTTGTTTCAGGCATCTTTGTCTCGATCAGTTGGTGCAGCCAGTTCATCTTCTCGGAGCAATACAAGGACAAGTAGCAGTTCTTCAGAGCAAAGGCTTCTTGTACCACCATTTACATCTTCAGGGGTGGTTGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACGTTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGATGAGGATAATTGTGCGGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGCGTCATGGCCTTGTTCTTGCCCTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGCTATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAAGTTCCACACCTTCAGCCCAGGGAACTTAG
  5   1   2       bld Em10      out                   IMAGE:7981704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAGACCGAATAATTCGAGTACAGCCTAAACCTGAACTGAAATCTGACATTTTAAAGCCCTCTAGTAAAGAGGAATTGGACTTACATTCATTAATGTGTGAGGATTGTGGAAAATGTAAGTGCCAAGAATGCACTTATCCAAGGACTCTCCCATCTTGTTGGATTTGTGACAAGCAGTGCCTTTGCTCAGCCCAGGAAGTAGTTGACTATGGAACTTGTGCTTGCTGTGTGAAGTGCCTTTTCTATCACTGTTCAAATGATGATGAGGATAATTGTGCGGACAACCCATGTTCTTGCAGTCAGTCCCACTGCTGCACTCGATGGTCTGCCATTGGCGTCATGGCCTTGTTCTTGCCCTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGCTGCTATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCCAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTCATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGAATCAATGTTCTGTGACGATTATTGTGTAAAGCATTGCAGCACAGG
  3   1   2       bld Em10 5g3  in                    IMAGE:7980550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGCTGCACTCGATGGTCTGCCATTGGCGTCATGGCTTGTTCTTGCCCTGTTTGTGGTGTTACCTTCCAGCCAAGGGTTGCGTTAAATTGTGCCAGGGCTGCTATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCCAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTCATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTGGAAGTTTATT
  5  -1   2       bld DMZ       out                        xl274a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGACCGCGTAAATAGACCTGGATGTCAATGCAAAAGATCAAACACAGTTTGCCTTAAAGTTCCACACCTTCAGCCCAGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTAATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAACCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGtatatttatttgaagttttattattttataaagagaaatatttattttatGAAG
  3   1   2       bld DMZ  5g3  in                         xl287n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAAATAGACCTGGATGTCAATGCAAANGATCCAACCCCAGGTTGCCTTAAAGTTCCACACCTTCAGCCCAGGGAACTTAGAAAAACCAACATAGCACAGGTGAACGGATGTTTATAAAGAACATAATAACTTAATTTAAACACTCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAACCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACAT
  5  -1   2       bld Lmb1                            IMAGE:8532249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTACTTTCGTGGGTCTCACAGTCTATGCAGTGTGCGGTATGCTGATCAGCAGTCACCATGCTAAGTCACACTCGCCAGACTAGAACCACATGCCAGTGACGATGTATAAGACATATACTCATTAACATCAATGCACCATCTGTACATTTCGAAAAAGGTGGGAAGAATTCCGTCTGCGGGAAATACTTTCCGTCAACGGATTAGCCTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGtatatttatttgaagttttattattttataaagagaaatatttattttatGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAATGaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGG
  3   1   2       bld Ga12                                 XL159f23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACACTCCAAATGCAACCATCTTGTTACATTTTCGGAAAAAGTGTTGGGATAGAATTTCCTGTCTGCGGTGAAATACTTGTCCGTCAACGGATTTAGCCTTAATAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCGACGAGACATATGTTCACTATAAAATAGAAATATATTAAC
  3   1   2       bld DMZ                                 rxl236h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TNANAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAANGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGNTTGTGAATAGTACTTGGAACATTTGTAAAATTNGCAAATGGCCTNTATTTNGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTNCAACTGTGAAAAAAAGNGCCANATNTGTATGGCACAGTCACANAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATNTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATACTTATTTGAAGTTNTATTATNTNATAAAGAGAAATANTTATNTTATGAAGCATCTNNCAAANGTCTCCCCCTTNTANGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATAT
  3   1   2      seed Ga12                                 XL146e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGAGAACCTCTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGC
  3   1   2       bld Tbd7                                 XL071j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAATAAAGCTTACAGTAGGATTCAATGTTCTGTGACGATTATTGTGTAAGCAATTGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAAC
  3   1   2       bld Ooc1                             Ooc1-db31e05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAGCACAGGCACTCCTATGTACCATTGTATTGTTTGTGAATAGTACTTGGAACATTTGTAAAATTTGCAAATGGCCTTTATTTTGCCAGAGATATTATGCTATATTTTTGTACATAAAACATATTTACAACTGTGAAAAAAAGTGCCATATTTTTATGGCACAGTCACAAAATTAACTAATGTACATTCAAAAGAATGTGAATCAATCAGTATGGTTACATTGTCCTTCGCCTTCTGGAACTTTAATATTATCGGACTTTTATTCTTTGGATCTTATCTATATTGTACAGTTACACTGTAAGATTCAGCCTTTATTTTCTAATGTTTCAATATTGTTTAGTGTAAAGTATATTTATTTGAAGTTTTATTATTTTATAAAGAGAAATATTTATTTTATGAAGCATCTTACAAATGTCTCCCCTTTTTATGATGTAAGATTCTGCAAATTGGGGCTGACTGAGACATATGTTCACTATAAAATAGAAATATATTAACGTCTGAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)