Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL437p02ex.5                         11 END     2          22       18                paired box protein 3 [Xenopus tropicalis]
     2   2.0    0Xl3.1-XL419e07ex.5                          6 END     4          44       66                paired-box 3 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL427g01ex.3                         11 PI      89          9      719                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012774008 Xl3.1-XL036l01.3 - 9 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL036l01.3             GGCTATTTTATTGTTAAAAAAAAAAGTTTGCGTTTGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGA
                                                  Xl3.1-CHK-1012696664                   TTTATTGTTAAAAAAAAAAGTTTGCGTTTGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTA
                                                      consensus depths                  2     2     3     3     3     4     3     4     3     4     3     4     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     8     8     5     5     5     5     5     5     5     5
                                                      Xl3.1-XL036l01.3                                                                                                                                                                                                          TAGTAG---------TAG---------------------------------TAA------------------------TAG------------------------------------------------------ATG------------------------------TAG---------------------TAA------------------------------ATG---------------TAA------------------------------------------------------------------------------------------------------TAG------TAG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA
                                                                   ORF            ... open reading frame                                                                                                                                                                       ]
  3   1   2       bld Neu7      out                        XL036l01.3p TTTTGTATTTTAGGCTATTTTATTGTTAAAAAAAAAAGTTTGCGTTTGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATAGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld DMZ       out                        xl235m10.3p             GGCTATTTTATTGTTAAAAAAAAAAGTTTGCGTTNGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTA
  3   1   2      seed Tbd7                                 XL084k05.3p                        TGTTAAAAAAAAAAGTTTGCGTTTGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld Tbd7      out                        XL060l20.3p                          TAAAAAAAAAAAAGTTTGAGTTTGGATAGACATTTTTCTACATTTGAGAACTTTCTACTCTCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAATTTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATTTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld Neu7      out                        XL049a17.3p                                                                                     TCTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACT
  3   1   2       bld Neu7      out                        XL036f09.3p                                                                                      CTAAGGGAAGACACATTCCACAATATTGTTTGTTGAAGGATCTCCTCCAGACTCTCAGAGTTGGATTTGGCTATGGTTTGGTTCAGATCTTTAAAAAAAGATATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACNGGCAACAAATNCTNCAATATGTTTCATG
  3   1   2       bld Neu7                                 XL015j18.3p                                                                                                                                                                                         TATTTCAGATCGGTATAGTAGGCAGTGGGTTAGGGATCTAAATGTCGAGTACTTAAGTTATATAACTAAAATGTTAAATCTTTCTTAATTGGCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld Neu7      out                        XL014p10.3p                                                                                                                                                                                                                                                                                      GCTAGGTGGAGCTCAACCTATATTGCGGTTATGTTTTATTGCTATCTGTAAAAATTCTAATGCAAACACTATTTGCATTGATAGGAAGGATTTAGCTTTCAACAGTTAAAGCGAAGTAACAAGAAAGTCACTGCCATGAAAGTGCTAAAATGGAGATTCAGATTTGGTAAAGGGGTGAAAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAG
  5   1   2       bld Gas3                              xlnga003c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAGAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)