Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4633419.3                       6 END     5          31       83                surfactant protein B [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4056110.5                       7 PI      90          1      552                hypothetical protein LOC779297 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012774089 Xl3.1-IMAGE:4057036.5 - 16 ESTs
                                                                       .......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4057036.5                                                                                                                                                                                                                                                        CACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGAAAAAGCAACGCAGGGTGATGGTGAGGATTTGCCAATACCAAAGCCCATGT
                                                  Xl3.1-CHK-1012691202                                                                                                                                                                                                                                                              TGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGAAAAAGCAACGCAGGGTGATGGTGAGGATTTGCCAATACCAAAGC
                                                      consensus depths                                                                                                                                                                                                                                                             9    11    11    13    12    14    12    14    12    14    13    14    13    14    14    15    14    15    12    15    13    15    14    15    14    15    14    15    12    15    14    15    13    15    13    16    14    16    15    16    14    16    15    16    15    16    15    16    16    16    15    15    14    14    14    14    12    14    11    14    11    13    12    13    11    13    10    11     8     9     8     8     7     7     6     6     5     5     4     4     2     3     3     3     3     3     2     3     2     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                ----------C-
  5   1   2       bld Lu1                             IMAGE:4056954.5p GAAGTCTAAGGGTAATGAGGGAGCTATCTGATTGGACTCTTTGGCAGGTATTGACTATGCAGCAGCAGACACATTGTAGTGTGTGCACTTCAGGTGTGTAAGCATTACACTCATAAGCGTTGACTCAGCCCAGTGTAAGCATTGGGACACTTCTGGGAAAGCCTTTCTACATCATTAACCCCCACCCCAAATATATAGAGCCAACACCTCAGAGATCCTACTCACTACACTGCAGAGATGGAAGGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAATGCATCACCCATCCAGGACACCATANAGAAATTNCTGCACAGGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTATTGGAAAAACAAGCGAACCCTGACGCTCTGTGTTCCACCCTGAAACTT
  5   1   2       bld Lu1       out                   IMAGE:4633438.5p                                                                                                                                                                                                                    tacgtcgacccacgcgtccgcccacgcgtccggGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGGAGCTCAATGTGGAGCCGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCGTAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAA
  5   1   2       bld Lu1                             IMAGE:4632789.5p                                                                                                                                                                                                                                             cccagcgtccgcccacgcgtccgGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCATTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGGGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGA
  5   1   2       bld Lu1                             IMAGE:4633021.5p                                                                                                                                                                                                                                                  AAGGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTTGTGTCAGGACCTGATGACTGCAGGTGAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGAANGNGAACATCTTGTTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTTCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTANGACGGCCACTGTCTTGTAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGG
  5   1   2       bld Lu1       out                   IMAGE:4633421.5p                                                                                                                                                                                                                                                    GGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGNGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGNGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAA
  5   1   2       bld Lu1       out                   IMAGE:4633782.5p                                                                                                                                                                                                                                                    GGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAA
  5   1   2       bld Lu1                             IMAGE:4633629.5p                                                                                                                                                                                                                                                     GGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAAAATTCTGGAATAATGAGCTGCAACCA
  5   1   2       bld Lu1                             IMAGE:4057036.5p                                                                                                                                                                                                                                                      GACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTNTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGANAAAGCAACGCAGGATGATGGTGAGGATTTGCCAATACCNAGCCCA
  5   1   2      seed Lu1       out                   IMAGE:4674032.5p                                                                                                                                                                                                                                                      GACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAG
  5   1   2       bld Lu1                             IMAGE:4058138.5p                                                                                                                                                                                                                                                       GACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCATAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCCGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTATTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGGAAAAAATTTCCCTTTAATTCAGGAGCATTTTGTCCACGCACATGAAAAAGCAACGCAAGGTGATGGGTGAGGATTTGCCATCCCAAAGCCCATGTGGCTT
  5   1   2       bld Lu1                             IMAGE:4674238.5p                                                                                                                                                                                                                                                        CACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCATTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTTGATTGGAAAAACAAGTGAAACCC
  5   1   2       bld Lu1       out                   IMAGE:4633419.5p                                                                                                                                                                                                                                                          CGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGAACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCCGACACTCTGTGTTGCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGA
  5   1   2       add Lu1                             IMAGE:4632631.5p                                                                                                                                                                                                                                                           CAGCGTCCGGAGGGACACGCCGATCGGCTACTTACCCGTGTGCAGCGAGTTCTGACGGGAAGTCCCAGTAAGGACGATGCGCCCGGGCCCGGGTTCTGGTGCAGGACCTGATGACATAGCTCAAGTNGGAGCCGGGACACTGCAGCAAACTGCCTGGTTAGGAAAAGAGTGCGGTGCGTGCAGTGTAAGCAGATCGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCGTAAAGAAATCCCGCACAAGCAGTGTTCCCATCTCCCTGGGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGAAGGNCACTGTCTTGGAAAAAAAGGGAACCCTGACACTCTGGGTTCCACCCTGGGGACTTGCCAATCTGACCAAGAAGAAATCTG
  5   1   2       bld Lu1                             IMAGE:4058608.5p                                                                                                                                                                                                                                                                     GCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTGCCTGTGGGGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGAT
  5   1   2       add Lu1                             IMAGE:4632677.5p                                                                                                                                                                                                                                                                                                                                 CGCCCTGGGCCCGGAGTTCTGGTGTCAGGAGCGGAGGACAGCAGCTTAATGTGGAGCCGTGGATCACTGCAAGCAAACTGCCTGGTGAGGAATAGATGTGCTGCGCGCGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCGTAAAGAAATTNCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAAC
  5   1   2       bld Lu1                             IMAGE:4632705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGCGTCCGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTCTTGGAAAAACAAGTGAACCCTGACACTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGAAAAAGCAACGCAGGGTGATGGTGAGGATTTGCCAATACCAAAGCCCATGTGCTGGATGTGCAAGTCGTTTATCAGCCAATTAGAGAAAGTCATCCCAAAGACAGTCATTGCCAAAGCAGCCTCTCAACTGTGCCGGATCCTTCCAGCGAAGGTAGCAGGTGTCTGCCAGTGTTTGGTGGAGAAATACACAGTTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)