Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk122h07ex.5                         8 END     5          50       62                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:7010808.5                       3 END     1          10       33                LOC443695 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012774133 Xl3.1-xlk122h07ex.3 - 10 ESTs
                                                                       .........-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk122h07ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCCTCTTGTCTCTTCGTTTCTCCCGCGTCCTCTGTTTCACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGTGACTGGAGGAGTTTGTAAGCTAA
                                                  Xl3.1-CHK-1012695936                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTGTCTCTTCGTTTCTCCCGCGTCCTCTGTTTCACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGTGACTGGxxGxxTTTGTAAGCTAATAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     5     8     2     7     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------G--
  5   1   2       bld Ga15      in                       XL477h04ex.5p GCAGATATTCTTGTGTGCACCCCAGGGAGGCTTGTAGATCATATTCAGCAAACAGAAGGATTTAACCTGAGGCATCTTCGGTTCTTGGTTATTGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAATCATGTTACTAAAGCAGTGTTTCGGTTGGAGGCTGGTTCTCCCAACATGCTATTCACCAGGAAAGAACCTGGAATACTCACAGCAGCCAGCTCTTGCCTTCACCAGACTCCTCTGCAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCAGAGAAACTAAAACAGCTAGGCCTGTACCAGCCCAGGCTCTTCATCTCCAAGCAAAAGGGAAATCCAAATGATTCCTCTGAAACACAAATGGAACCAAGTATATCAGGGAATTTTTCACTTCCAGAGGGGCTTACGCATTACTACATTCCATGCAATCTGAATTCTAAGCCTCTTATCCTTCTACACTTCCTCTTGTCTCTTCGTTTCTCCCGCGTCCTCTGTTTCACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAG
  3   1   2       bld Ga18      out                     xlk122h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                            TNTNTCAGGNANTTTTNNCnnnnnnGGnnnnnnGCANTNCTACNNNCNATGNANTCTGAATTCTAAGCCTCTTATCCTTCTANNCTTCCTCTTNNCTCTTCNTTTCTCCCGCNTCCTCTGTTTCACCAACTCAAGGGACNCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTGAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGTGACTGGAGGAGTNNNNNAANCT
  3   1   2       bld Ga15      in                       XL477h04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTACACTTCCTCTTGTCTCTTCGTTTCTCCCGCGTCCTCTGTTTCACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCCCAGGTGACTGGAGGAG
  3   1   2       bld Ga15      out                      XL495g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTCCTCTTGTCTCTTCGTTTCTCCCGCGTCCTCTGTTTCACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACATTAAACTCATCTGCCGTTTGGAGAACCTAGCTATTGACTGCATCCCTATAGTCAGTAATGCTGGAACCGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAAGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAAGTGGGAAACCCAGGTGACTGGAGGAG
  3   1   2       bld DMZ  5g3  out                        xl321l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACCAACTCAAGGGACGCCTCCCACCGCCTGTATCTGCTGATCCGTAGTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTCAGTACAGATGCAACAGCAAGAGGAATTGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACATTAAACTCATCTGCCGTTTGGAGAACCTAGCTATTGACTGCATCCCTATAGTCAGTAATGCTGGAACCGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAAGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAAGTGGGAAACCAGG
  3   1   2      seed DMZ       out                        xl331h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTGGAGGAATCGATGTGGCAGAATTCTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTGAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGAA
  3   1   2       bld Tbd7      out                        XL058g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTCCAGGGGAGAGGAAGAGGACCCTGAAGGAATTTGAGCAAGGGAAAGTTCAGTTGTTGGTGAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGGACGGAGGAGTATTTGTAAGCTAATAAATAC
  3   1   2       bld Tbd7      out                        XL106o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAAAGTTCAGTTGTTGGTGAGTACAGATGCAACAGCAAGAGGAATCGATATCAAGGGAGTCAAATGTATAATAAACTATGATGCGCCACAGTTCATTCGAACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGNACGGAGGAGTATTTGTAAGCTAATAAATACATTTTAT
  3   1   2       bld Ga18      in                      xlk151f07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGTCGAACAGCTCGTGCAGGGAAAGCTGNCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGGGCCCCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGNCCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAANCCAGGTGACNNGAGGAGTA
  5   1   2       bld Ga18      in                      xlk151f07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGAAAGCTGGCCTAGCATTCACAATGCTGCTTAAAGTTCAGGAAAAACCCTATTTTGGTATGTTGAGGGATGCTGGNNCNCAGAGCTGCAAAGGCAACTGGTAAAGAGCGAGTGTCTAAAGCAATATGAGCAGCGATATGAAGAGGCTCTAAGTGAGTTACAGAAAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCGTGAGACTAGCTATATGACACTAAACTCATCTGCCGTTTGGGGAACCTAGCTACTGACTGCATCCCTATAGTCAGTAATGCTGGAACTGAGCTTTCAAATATGCCTATAGACTTGTTCAGCTACCAGACCCTAGGGTCAACCAGCCTGACCATCAAGTACTGCTCCTGGTGAGCTCATCCTTTTTGTGTTTGCCCATATCAGTAGGGTTCACAAGTGCCAGAAAGTCGGAAACCAGGTGACTGGAGGAGTATTTGTAAGCTAATAAATACATTTTATTTATTTNaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)