Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012774229 Xl3.1-xlk160p04ex.5 - 16 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk160p04ex.5                                                     TCATGTTATGAGTTGTTAGCGTTAGCGCCCCACATCAAAACTAAAATTTCTATGGACTAATCACGAGCACATTAAACTTCAATTGTTATCAAGGAAGAAAATGTTATCGCGCCATCCACCGTGACGTCATTAAGGACTTAAACTACAATTCCCTTCATGCCGTACGGCTGTTGCCTTCCAGTTCCGGTTTTGGAAGTTCAGCGGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTACGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGCTTATACCAGTTTTATATAAATAAAGCCTTTTCATTAAAA
                                                  Xl3.1-CHK-1012691193                                                           TATGAGTTGTTAGCGTTAGCGCCCCACATCAAAACTAAAATTTCTATGGACTAATCACGAGCACATTAAACTTCAATTGTTATCAAGGAAGAAAATGTTATCGCGCCATCCACCGTGACGTCATTAAGGACTTAAACTACAATTCCCTTCATGCCGTACGGCTGTTGCCTTCCAGTTCCGGTTTTGGAAGTTCAGCGGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTACGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGCTTATACCAGTTTTATATAAATAAAGCCTTTTCATTAAAAACATGT
                                                      consensus depths                                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     4     6     5     6     5     8     7     8     7     8     7     8     8     8     8     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8    10     7     9     7     9     7    10     7    10     8    10     8    10     9    10     9    10     8    10     8    10     8    10     7    10     7    10     8    13     9    13     8    13     9    13     9    13     9    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    11     8    11     8    11     8    11     8    11     8    11     8    12     8    12     8    13     8    13    10    12    10    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9     9     8     8     8     8     7     8     5     8     5     7     5     7     5     7     5     7     5     7     5     7     5     6     4     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                             ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                               BLH ATG     265     121                                                     
                                               BLH MIN     265      36                                                     
                                               BLH MPR     202      36                                                     
                                               BLH OVR     265     295                                                     
                                               CDS MIN     265       1                                                     
                                               EST CLI     174       1                                                     
                                               ORF LNG     265      26                                                     
  5   1   2       bld Oo1  5g                         IMAGE:6856879.5p CTTCGAACCGGAAACAATTCCCTCAGTTAAACATTTGTCGGGACTTGTTGTTTCATGTTATGAGTTGTTAGCGTTAGCGCCCCACATCAAAACTAAAATTTCTATGGACTAATCACGAGCACATTAAACTTCAATTGTTATCAAGGAAGAAAATGTTATCGCGCCATCCACCGTGACGTCATTAAGGACTTAAACTACAATTCCCTTCATGCCGTACGGCTGTTGCCTTCCAGTTCCGGTTTTGGAAGTTCAGCGGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGTTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAAAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTACGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGGTCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAAGCAATTCTGGAACGTTCTTCTCTCTGGTCCTTCTGGAGCTGACATGTTAGAAATGGTTTCCAGGATTTTAGAAGAACCCCTACCGAAAACCAATACCCTGCCAAAGGAAGCCTTCTCCCCTACCAGTGGGGGGGACTATCCGTTTTGGCCAAATAATTTCAGGGATTTTGCCCCCCAGGTCCCTGGGGGGTTAAAACGTGGCAAAAATGCAA
  5   1   2       bld Egg3 5g                         IMAGE:6870252.5p                 GATTCCCGGGGTTAACATTTGTCTCGACTTGTTGTTTCATGTTATGAGTTGTTAGCGTTAGCGCCCCACATCAAAACTAAAATTTCTATGGACTAATCACGAGCACATTAAACTTCAATTGTTATCAAGGAAGAAAATGTTATCGCGCCATCCACCGTGACGTCATTAAGGACTTAAACTACAATTCCCTTCATGCCGTACGGCTGTTGCCTTCCAGTTCCGGTTTTGGAAGTTCAGCGGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTACGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGNGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGGTGAAGATATTTTTATTAAGTGTATCCCTTCTTTTCGCACA
  5   1   2       bld Oo1  5x                         IMAGE:6638478.5p                                                                                                                                                                                                                                   CACGCGTCCGCCCACGCGTCCGAGCGGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGTTTGGAATAGGAAGTTAACGCTGCCTGGGATGTCTCGAAAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGACTATGGAGGATTACTTTTGCGAAGATCCCTAAAATCAAAAAGTTGGTCTACGGCTGGCATAGAATAAGGNGACTCGTGTAAAGTCAAAGTGGGTTGGGGTCCCGTCCTTTTAACATGGGATGGAAGACCTAATTGGGTTGAAAAATAAAATTGGGGCCCTTTGAAAAACAAAATTTTCTTGGGGAACAGGGTCCTTTcccccccggccccTCCGGGAACCTGGAACTTGGTAAAAAAGGGTTTCCCACGATTTTTTGGGGAAACCCCCCTTTCCGGAAACCCCCTTTTCCTCTTTCAAAAAGAAAAACATTTTCCCCCCACAAAAAgggggggggggaaaataattccttttttggccaaaaaaattttcccggggggtttttgggcccccccaaacttttgggggggggAAAAACAAGTGGGGGGNNAAAATGGGGNNNNNTTTTCTTTTTTTCCCCaaaaaaaaaaaaaaaatattcttttttttttGAAAAA
  5   1   2       bld Eye1 5g3  in                    IMAGE:6947905.5p                                                                                                                                                                                                                                                GACCGGTCCGGAATTTTCCGGATCGGTTCCAGGTGTGGTGCAATACAAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTATGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGGAGCATCATTTTTGATGTCTTGGAACTTGAAACATTGTCCCAACATTGGTATTCCCCTATTTTTTATGAAGATATAAGGT
  5   1   2       bld Tbd5 5g3  in                    IMAGE:3580770.5p                                                                                                                                                                                                                                                          TCAGCGGNAACAGCGGTTCCAGGTGTGGTGCAATACTAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTA
  5   1   2       bld Ooc3 5g                         IMAGE:3436451.5p                                                                                                                                                                                                                                                               GGAAGCAGCGGTTCCAGGTGTGGTGCAATACAAGCGCTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTATGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAG
  5   1   2       bld Ga18 5g3  in                      xlk160p04ex.5p                                                                                                                                                                                                                                                                                   TGGTGCAATACAAGCGTTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAAAAACCAGCACTTGTTTCTGTGCAGCAGTCNNTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTACGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTNCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGANATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGNCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGANATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGNCTGAAGCTTTNNNTNNATTTNNTG
  5   1   2       bld Egg1 5g3  in                    IMAGE:3301461.5p                                                                                                                                                                                                                                                                                        GCACGAGGGCGTTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAAAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACT
  3   1   2       bld Eye1 5g3  in                    IMAGE:6947905.3p                                                                                                                                                                                                                                                                                                                                                                            GAAAGAAATGGGAATATAGCTACCAACTTTTTGGGAGGTGCGGACCCCCACCCCCTCCAATTTCTTTTAAGTTATTTCTAGCAGAACCGGTTTACAAGGCTTGCCAAGAGAGTAAATGTTTAAGAAAAACCCCCCTAAGGCCAGCTTTACTAACCTTGCAAGAACACCTCAGTTTTAAGGTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTGTCTATGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTATCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATGTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGGATATAC
  3   1   2       bld Ga18 5g3  in                      xlk160p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCNCANTNCTTTAAGNAATCTANNAGAACAGCTACANNNATGCCAGAGAGTAATGTTTAAGAAACCCCCCTAAGCAGCTTTACTAACCTGNAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTNTCTACGCTGCATAGAATAANGGACTCTGTAAGTCAAGTGGTTGGNTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGNCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGNNNNNTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAANCNNNNNNGCTTA
  5   1   2      seed Egg2                   IMAGE:3301461-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCGTTTGGAATAGGAAGTTAACGCGCCTGGATGTCTGAAAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGCTTATACCAGTTTTATATAAATAAAGCCTTTTCATTAAAAACATGTaaaaaaaaaaaaaaaaaaaGATTCGCGGGCCGCA
  3   1   2       bld Ga18      in                      xlk118a05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTGCATAGAATAAGGGACTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGNNNNTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTANTCTCTATATAATATAACTTATGTAATATAAANCNNNNANGNTTANNNCAC
  5   1   2       bld Ga18      in                      xlk118a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATAGAATAAGGGANTCTGTAAGTCAAGTGGTTGGGTCCGTCCTTTACATGTATGAGACTAATGTTGAAATAATTGGCCTTGAAGCAATTCTGGAACGTTCTTCTCTCTGTCCTTCTGTAGCTGACATGTTAGAATGGTTACAAGATATAGAGAAACACTACAGAAACCAATACCTGCAGAGGAAGCTTCTCCTACAAGTGTGTGACTATCGTTTGTCAGATATTCAGGCATTGCCTCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGNCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGCTTATACCACTGTTTTATATAAATAAAGCCTTTTCATTAAAACNA
  5   1   2       bld Egg5 5g                         IMAGE:3430943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTTAACGCGCCTGGATGTCTGAGAAACCAGCACTTGTTTCTGTGCAGCAGTCGCTAAGGAAGTGCTTTGATACTATAGAACCACTGCACGAAGAATGGAATACTACACTTTTGGAGTGCGACCCACACCTCAGTTCTTTAAGTAATCTAGCAGAACAGCTACAGGCATGCCAGAGAGTAATGTTTAAGAAAACCCCCCTAAGCAGCTTTACTAACCTGCAAGAACACCTCAGTTTTAAGCTACAAGCAGCTATGGAGGTTACTTTGGAGATCCTAAATCAAAAGTTATATTTTATTAAGTGTATCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAA
  3   1   2       bld Egg1 5g3  in                    IMAGE:3301461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTCTTGGGTTAAACTGGCAGATGCAGCATCATCCAGACAGCAGCTTGTTGAAGATATTTTATTAAGTGTAGCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTCCAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATATAAAACTGCCCACGCTTATACCAGTTTTATATAAATAAAGCCTTTTCATTAAAAACATGTAAAA
  3   1   2       bld Tbd5 5g3  in                    IMAGE:3580770.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTACAAGATATAGAGAAACACTCCAGAAACCAATATTTTATTAAGTGTATCCTTCTTTCGCACATCTACGTGACACTGATATTCTTCCTGAATACTTCTCAGAACTTACTAGTTGGAATGGCCTGTTCCGAGATGGAAATACTTGAAAATTAACTTTAAGGGTCTGTTAAATGTAGAACACTTGGGAGCATCATTTTGATGTCTTGAACTTGAACATTGTTAAACATTGTATTCCTATTTTTATGAGATATAAGTCCAAAACTCATGGCTGAATAAGAAAATGGATCCATTTACCACATCTCATTGGACTGAAGCTTTGCCTGCATTTGCTGGAGTTAAATCCATACTTCTGAACATTATTCTCTATATAATATAACTTATGTAATGTAAAACTGCCCACGCTTATACCACTGTTTTATATAAATAAAGCCTTTCATTAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)