Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk135a19ex.3                        17 END     2          15       11                dapper 1 [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:5085057.5                      13 END     1           7        7                dapper 1 [Xenopus laevis]
     3   2.0    0Xl3.1-IMAGE:6642149.5                       7 END     1           7       14                Frodo [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4   0.0    0Xl3.1-PBX0159F12.5                          9 PI      90        459     1452                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012774568 Xl3.1-IMAGE:6643738.5 - 13 ESTs
                                                                       .....-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6643738.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTTTCTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTGTGTTCTTTACCACTTTCTTCCGCGAAAAAAATGGATGGTTACATTTTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGGATTTTACGACATGGGAGTATGTGTGTCAAACAGACTGGTGGGGTTTCTCAAAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACATAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTAGGCGAGCCCAGGGAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAGAGTGTGAGTCTCTGTTTCACTCCACGGTGGTAGACACAAGTGAGGATGAACAAAGCAATTACACAACAAACTGCTTTGGGGACAGTGAATCCA
                                                  Xl3.1-CHK-1012692855                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTGTGTTCTTTACCACTTTCTTCCGCGAAAAAAATGGATGGTTACATTTTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGGATTTTACGACATGGGAGTATGTGTGTCAAACAGACTGGTGGGGTTTCTCAAAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACATAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTAGGCGAGCCCAGGGAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAGAGTGTGAGTCTCTGTTTCACTCCACGGTGGTAGACACAAGTGAGGATGAACAAAGCAATTACACAACAAACTGCTTTGGGGACAGTGAATCCACTCTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     4     4     5     3     6     5     6     6     6     6     6     7     7     7     7     7     7     7     7     7     8     8     8     8     8     7     8     8     8     7     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 7e-007     XP_001254757.2 PREDICTED: similar to dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Dr ---- 3e-065     NP_999896.2 dapper 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Mm ---- 1e-110     NP_067507.2 thymus expressed gene 3; dapper 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Hs ---- 2e-128     NP_001072988.1 dapper 1 isoform 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Gg ---- 3e-131     NP_001038157.1 dapper 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Xt ---- 0          CAJ81395.1 dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Xl ---- 0          NP_001083910.1 dapper 1 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6643738.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  3   1   2       bld Egg3      out                   IMAGE:3378252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGACAGAAGAGCATCTGGAGACAGACAGCCGACCCAGTTCAGGATTTTATGAGCTGAGTGATGGGACTTCAGGATCCCTCTCCAATTCCTCCAACTCAGTGTTCAGCGAATGTTTATCCAGCTGCCACTCCAGCACCTGCTTTTGCAACCCCTTGGAAACATCATTAAACCTCACAGATGGTCAAGCAAAGTCTGCAGACGACTTTCTTGAATGGTTGGACTACAGAGAAAGTCAACATGAAACTGGCACAGTTCGCCGCTCCTTTTCTGCACCACATTCCAACTCTGTCGACATTGGGGCAGATGTGCACCCCAAATATCAGTGTGACCTGGTATCTAAAAATGGTAATGATATCTATCGTTACCCCAGCCCACTTCATGCAGTAGCTGTGCAGAGTCCTATGTTTCTGCTTTCTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTG
  5   1   2       add Ga18                              xlk128j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAAGNCAACATGAAACTGGCACAGTTCGCCGCTCCTTTTCTGCACCACATTCCAACTCTGTCGACATTGGGGCAGATGTGCACCCCAAATATCAGTGTGACCTGGTATCTAAAAATGGTAATGATATCTATCGTTACCCCAGCCCACTTCATGCAGTAGCTGNNNGAGTCCTATGTTTCTGCTTTCTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTGTGTTCTTTACCACTTTCTTCCGCGAAAAAAATGGATGGTTACATTTTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGGATTTTACGACATGGGAGTATGTGTGTCAAACAGACTGGTGGGGTTTCTCAAAGCANNNNGNTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTNAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTNNNAAGTAAAAGGATGCCATCCATCTCCACNTATCCTTCTTGTAATGTCAATGAACTTCAAAGNCAA
  5   1   2       bld Ga12      out                        XL190c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGTTTCTGCTTTCTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTGTGTTCTTTACCACTTTCTTCCGCGAAAAAAATGGATGGTTACATTTTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGGATTTTACGACATGGGAGTATGTGTGTCAAACAGACTGGTGGGGTTTCTCAAAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTC
  5   1   2       bld Ga12      out                        XL199f22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCTGCTTTCTGTCATGGGCAACATAAAGGCAGAGGAACCAGAGGAGGGGATTGACCACAATGATAACGATGACTGTATAGTGCCTGAACTAGACCACTTAAAAGACGAGGACTCTTTTCTCCATCAGAGCAGCCTGTGTTCTTTACCACTTTCTTCCGCGAAAAAAATGGATGGTTACATTTTAAGCATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCAAGGACTAGTGTCAATGCTGACCCAGGCAAAGGGATTTTACGACATGGGAGTATGTGTGTCAAACAGACTGGTGGGGTTTCTCAAAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTC
  3   1   2       bld Ga12      out                        XL165e18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGAAAAAAATGGATGGTTATATTTTAAGTATCATACAGAAAAAAGCACATCCTGTAAGGACTAACAAACCCAAGGACTAGTGTCAATGCTGATCCAGGCAAAGGGATTTTACGACATGGGAGTATATGTGTCAAACAGACTGTTGGTGTTTCTCAAAGCAATGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCGCCGGAATGATCTCTGTGGATAATAGCACTTATCCTTCTCTAAAACCGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCTATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACAAAACACTGTGAAGTCTGTGTGTCAGGGTCTGGCAAGGGGCTCTGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACCGGCTAATCTCCCTAATGCATCAAGTTCTGTCTGTAATGGATCTCCTAGAGAAAGCACACAGAACAGTGCACTGCTCCCTCAAGAGATTAAAGTTGTGCCACCAGTAAAGCGAGTTTCCCCGAAAAATACANTCCTTTCATNCCATGAATCTTCATCTTTTGACGAAAGACCACCTCTGGACTTTAAAAGCGAGGGGTCGTCATCTCAGAGTTTGGATGAAGGGATGCTGGTTAATGCTCATTATATACCAGCTCAGCAACAT
  5   1   2       bld Oo1                             IMAGE:6643738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGATCAACAGACTGGTGGGGTTTCTCACAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAAAAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGCTaaaaaaaaCTGCTCACCCTCATTTCCAAACCTGGCAGAAGTTGGAAAAAAATCCGGGTTGCAAGCCAGATCTTGGAAACAAATCTTCATGGACACTCAAAAAAATGTGGGTCCTGGCCCAA
  5   1   2      seed Oo1                    IMAGE:6643738-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGACTGGTGGGGTTTCTCAAGCAACGCAGTTAACCTGAAAAATTCTAAACAAACATGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGT
  5   1   2       bld Ooc1                   IMAGE:3745885-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTTTACATTCCACCGGAATGATCGCTGTGGATAATAGCACTTATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAATGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGACAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACCATAA
  5   1   2       bld Oo1                             IMAGE:3405419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCCTTCTCTAAAACAGTGCTCAAAGGAGTCTCTAAGTGAACAGCTGGAAAGTAAAAGGATGCCATCCATCTCCACATATCCTTCTTGTAATGTCAATGAACTTCAAAGCCAAAACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGA
  5   1   2       bld Emb1                            IMAGE:6865795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAATTCACGAAATACTGTGAAGTCTGTGTGTCAGGGACTGGCAAGGGGCTCGGTAGCAATGACCTCAAATGTTCAAAAGGAAAATGTTACACCCAATGCACTGGCTAATCTCTCTAATACATCAAGTTCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACATAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTANGCGAGCCCAGGGAAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAG
  5   1   2       bld Ov1                             IMAGE:6316306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTGTCTGTAATGTAACTCCTGGAGAAAGCATGCAGAACAGTCCACTTCTTCCACAAGAGATTAAAGTTGTGCCACCAGTGAAAAGAGTTTCCCCCCAAAACACACTCCTTTCTTATCATGCATCTTCGTCTTTTGATGAAAGACCACCATTGGACTTTAAGAGCGAGGGGTCATCATCTCAGAGTTTGGATGAAGGGCTTCTGGTCAACGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACATAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTAGGCGAGCCCAGGGAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAGAGTGTGAGTCTCTGTTTCACTCCACGGTGGGTAGACACAAAGTGAGGATGGAACAAAGCAATTTACACAACAAACTGCTTTTTGGGGGACAGT
  5   1   2       bld Emb1                            IMAGE:6864511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCGCTCATTATATACCAGCCCAGCAACAGGGTGTTAAACTTCATAAGCATACCAAATACGTGAAGATCGTGAAAAGCTCCACTTTAAAACATAGAGCGAATGTTCAATATGTGGCAGAAAATGGATCCCAGACGCTGAAAGAAAAGAGCAAGGTTGTGGGAAAGAAGTGCAGGTTCCCAGATGACTTGGATACAAACAAAAAAGTGAAGAAATCCACTCTGCGGGTTAAAAAAACTGCTCACCCTCATTTCGAACCTGCAGTAGTTGGAAGAAATCCGGTTGCAGTCAGATCTGGAAGCAAATCTCATGGACACTCAAAAGATGTGGTCTTGGCCAAACCTAAACATAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTAGGCGAGCCCAGGGAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAGAGTGTGAGTCTCTGTTTCACTCCACGGTGGTAGACACAAGTGAGGATGAACAAAGCAATTACACAACAAACTGCTTTGGGGACAGTGAATCCAGTCTGAGTGAGGTTGAATTTGTTGGTGAAAGCACAACGTCAAGTGATACTGATGAAAGTGGAGGACTCATATGGTCCCAGTTTGTACAAACGCTTCCCATGCAGGCCACTGCGACTGCTGAACTACAAACCACCGCAAAAGCCTTTGTCAAAATCNAAGGCATCGCACAACCTAAAGAAGAAAAATCCTTCGCCTTCAGATCTGGGGTCTTTTAAAGTTGAATGACAACCGGTTTTGAGGCACCAACCTAGGTCAAATGGTGTTTCAGGCT
  5   1   2       add Egg3                            IMAGE:6870435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTCCCCGGGCTTGGCCAACCTAATCCAAGAGGGGCGATTATCGAAGATGGAAGTCTTCAGCCGAGATTTCTTATGAAGAAGCATTAAGGCGGGCACGTAGGCGAGCCCAGGGAGAAATGGTGGGTGTTTATGCCCAAGTGCCATTTCCTTACTCCAGCCCATATGCTTATATCGCTAGTGACTCTGAATACTCTGCAGAGTGTGAGTCTCTGTTTCACTCCACGGTGGTAGACACAAGTGAGGATGAACAAAGCAATTACACAACAAACTGCTTTGGGGACAGTGAATCCACTCTTAAGTGAGTGNGAATTTGTTGGTGAAAGCACAACGTCAAGTGATACTGATGAAAGTGGAGGACTCATATGGTCCCATGNTGTACAAACGCTTCCCATGCAGACACCTAAAAGACGAGGACTCTTTTCTCATCAAGCAGCCTGGTGTCTTTACCACTTTCTTCCGCGAAAAAATTGGAGGGTCCTTTTATAGCCCTCTTCCaaaaaaaaCCCCTTCCCGGAAAACCCCAAGGGTTCCGGCTTTTCTGGCCTGGGGCAACCCTAAAGGGCCAGAGGAACCCCCAgggggggggggtgccacnncntgagaaaacaatatggtnnnnnnnnnTGTGCTGGGATATAAAAAACACCCCCCCAGANNNACCTTTTTTGTaaaaaaaagaggggggcccccccccccccctaaaaaaaaaaaaaaacccccccTCCCTCTCCAAACAAAGGGGGGGCTTTTTAAAAAGGGGTGAGAAAACACACCCGTTTTTTGAAAGccccaccccccanaaaaggaaggggggtttcccctttacaaaaacccccccttttttttATTTGGTGGCAAAACAAATTCAACCTCTCTCGGCCGCCCCTTTTNAAAACAAAAGGAAACAAGGAGGGGNNCCCCNNNNCNNNNNCCNNCCCCCNNAAAAATTCTGGGGGCGGGCGCCATATCCTCCCACCAACAGGGGGGAGAAACACCAAACACAAATAAcccccccccccTCCTTAATATGGCCCGGGGGGACGCCCCCAAAAGGACNTNCTTGTAACCTTTTCCTTCCTTTCGTGGTGGGGAAACAACACCNNNNNTNCCNNNccctntcccccccaatccggggccccccTCTAACTACTCTTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)