Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl261l09.5                            9 PI      81        232      599                mitogen-activated protein kinase kinase 1 interacting protein 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012774607 Xl3.1-IMAGE:8076246.5 - 27 ESTs
                                                                       ...-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8076246.5                                                                                                                            CGTGGAAAAAGGTTGAGGAGAAGAAAGTTGGTTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCTTTTTTATATATATTTTTTTAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAAA
                                                  Xl3.1-CHK-1012688414                                                                                                                                  AAAAGGTTGAGGAGAAGAAAGTTGGTTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCTTTTTTATATATATTTTTTTAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTG
                                                      consensus depths                                                                                                                                 2     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     7     6     7     7     9     8    10     8    10     8    10     8    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    10    10    10    10    10    10    10    10    10    10     9    10    10    10     9     9     9     9     9     9     9    10    10    10    10    10     9    10     9    10    10    11     9    11     9    11    10    12    10    12    10    12     9    13     9    13     8    12     8    12     8    12     8    12     8    12     8    11     9    12     9    12     8    12     7    12     7    12     7    11     7    11     7    11     6    10     6    10     6     9     6    10     6    10     6    10     7    10     7     9     7    10     7    10     7    10     7    10     6    10     7    10     7    10     7    10     7    10     6    10     6    10     5    10     7    10     7    10     7    10     7    10     8    11     7    11     7    11     6    10     6     9     6     9     6     9     6     9     6     9     6     9     7    10     7    10     9    12     8    12     8    12    10    12    10    11    11    12    11    12    11    12    11    12    11    12    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    12    10    12    10    11     8    11     8    11     7    11     6    10     6    10     6    10     4     8     3     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --G---------
                                               BLH ATG     247     415                                                                                                                            
                                               BLH MIN     247      53                                                                                                                            
                                               BLH MPR     238      53                                                                                                                            
                                               BLH OVR     247     800                                                                                                                            
                                               CDS MIN     247      53                                                                                                                            
                                               ORF LNG     247      11                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 8e-010     XP_643998.1 hypothetical protein DDBDRAFT_0217502 [Dictyostelium discoideum AX4] =======================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ag ==== 5e-024     XP_309192.2 ENSANGP00000018687 [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dm ==== 1e-025     NP_609843.1 CG5110-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 6e-035     XP_001184514.1 PREDICTED: similar to mitogen-activated protein kinase 1 interacting protein 1 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 4e-049     NP_001018410.1 hypothetical protein LOC553597 [Danio rerio] ======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Mm ==== 6e-052     XP_926669.1 PREDICTED: similar to Mitogen-activated protein kinase kinase 1 interacting protein 1 (MEK binding partner 1) (Mp1) isoform 4 [Mus musculus] =========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 5e-053     NP_068805.1 mitogen-activated protein kinase kinase 1 interacting protein 1; MEK partner 1;MEK binding partner 1 [Homo sapiens] ==================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Cf ==== 4e-053     XP_862390.1 PREDICTED: similar to mitogen-activated protein kinase kinase 1 interacting protein 1 isoform 4 [Canis familiaris] ===================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bt ==== 3e-053     NP_001069450.1 mitogen-activated protein kinase kinase 1 interacting protein 1 [Bos taurus] ======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 3e-053     NP_001006559.1 similar to mitogen-activated protein kinase kinase 1 interacting protein 1; MEK partner 1; MEK binding partner 1 [Gallus gallus] ==================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xl ==== 4e-063     NP_001079867.1 hypothetical protein LOC379557 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8076246.5                                                                                                                                         TGA------------------------------------------------TAA------------TGA---------------------------------------------------------------------------------------TGA------------------------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAG------------TAG---------TGA---------------TGA------------------------------ATG------------------------------TGA---------ATG---------------------------------------TAA------------TAG---------------------------------------------------TAA------------ATG---------------------------TGA------ATG---------------------------TAA---------------------------------ATG------------TAA------------------------------TAG------------------------------------------------------------------TAG------ATG------------------TAATGA---------------------TAAATG------------TAG---------------------------------------TGATAA------------------------------------------------TGA---------------------------------------------------------------------------TGATGA---TAA------------------------------TGATGA---------------------TAA---------------------------------------------------TAA---ATG------------TAATAATGATGA------TAA------------------TAG------------------------------TGA------------------------ATG---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Lmb1 5x3                        IMAGE:8535730.5p AAAANCCCTATNCNNTGCGGATCATCGATTGAATTGTCCCGCTGAGAGAGCAGCAAACAAAATATGCCTACTTATAGATCAGGAAGCGGGTGAAAGGTAAAATTGTCGACTACTTAGTGAATCCGTGGAAAAAGGTTGAGGAGAAGAAAGTTGGTTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAATGAAGAGCTTGGGGACTGTNNTGAGACTTCACATGCAGTGAAATCTAGAAGAAATAATCTATTCAGTCTATACTGTATTCCATAATGTAGCAGGATGTGTAGTCNGACTGACTTACGCGCCTGACTGCAATACTCCTGCCAGCTGTCTCC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4962726.5p                                                    AAACAAAATTTGCCTGCTTATAGATCAGGAAGCGGGTGAAAGGTAAAATTGTCGACTACTTAGTGAATCCGTGGAAAAAGGTTGAGGAGAAGAAAGTTGGTTGCTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGGAGTAAGCTTTGGACTCTCCAAAATAAAAGTATC
  5   1   2       bld DMZ  5g3  in                         xl222e03.5p                                                                                                           CATCGATTCGGTGAATCCGTGGAAAAAGGTTGAGGAGAAGAAAGTTGGCTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTAGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATNAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTANCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACNACACATGCCAGGTTGTTCANTTCANCCGACTGCCTTTGGTTGTAANCTTCATTGCNNGTANTGNTGCCNACNCNNGCCTCCTTCTCNNCTTANNTGANNANCTCNNNNACTTGNTTG
  5   1   2       bld Te2N 5x3                        IMAGE:7766069.5p                                                                                                                                  AAAAGGTTGAGGAGAAGAAAGTTGGTTGCTGCTGCCGCACTCACGTGATCATAAAGCTTAATGGGCGGATCTATGAAGTGAACTGAGTTATGGGAATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACCGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTCGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGGACATGCAGAATAACATCACCTGCACTAGGCATGGTTCATCACTCCACATTTATTTTACTTTCTGATCGCAA
  5   1   2       bld Tail 5x3                        IMAGE:8545565.5p                                                                                                                                                                                                                      AAAANNCCAACGTTTNNNAGAGAGTCCTAAAACTATTCGTCCAGAGACTGAGCAGTTGTGTAGGGTGACATTGGCGGACTTACAGCGGAGACTCGAGCGTGTACGAGAGGGGCCTTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTCGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTAACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCTTTTT
  5   1   2       bld FaB  5x3                        IMAGE:8072285.5p                                                                                                                                                                                                                                GATGTAGAAGAGCCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTAGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACCGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTCGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAATTCTATTTCAGTTCTATACTGTATTCCCATAGAGTTAGCAGGGAGTGTTTNAGGCCGGAGCTGACTTTACGCGCCCTGACATGCAAAAACTCCCTGCACTAGCTGTTCTCCTTCCCTTTATTACTTCGATCCAAGAGGGCGTGACCCTCACCTTTTTTATATTTTAATCAGTAATAGCCCCAAGCTCACTAACCAGCTTGGCATAAAATAGG
  5   1   2       bld Egg1 5x3                           PBX0080F11.5p                                                                                                                                                                                                                                            CCGAATAGCACCAGCGCATTCACTTTTTCTAGGAAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACT
  5   1   2      seed Sp1  5g3  in                    IMAGE:4963899.5p                                                                                                                                                                                                                                                                    TTTTCTAGGTAGAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCC
  5   1   2       add Egg1 5g                            PBX0108H10.5p                                                                                                                                                                                                                                                                           GGAGCTGGGGGTATCGGGCTGAGAGAGCAGCAAACAAAATATGCCTGCTTATAGATCAGGAAGCGGGTGAAAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8076246.5p                                                                                                                                                                                                                                                                               GAGACTGAGCAGTTGTGTAGGGTGACATTGGGGGACTTACAGCGGAGAATCGAGCGTGTACAGTGCTAGATATTGAAGAGAAAAACAAAACAGCGCAGATATGGCTGAGGAGTTAAAGAGATTTCTATACAAGAAGTTACCAAGTATTGAAGGACTCCATGCCATTGTTGTATCTGACAGAGATGGTGTACCGGTTATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCtttttatatatatttttttAAATTTCGTTATATAGGCACACCCCAAAGCTGCCCCCTAAACCAGGCCCTTTGCGCAATATATAATATGGCCT
  5   1   2       bld Ga18      in                      xlk143j14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAAGTTGCCAATGAGAATGCTCCTGAACTTGCTTTGAGACCTAGTTTCCTTTCTACATTTGCACTAGCAACAGACCAAGGAAGTAAGCTTGGACTCTCCAAAAATAAAAGTATCATCTGTTACTACGACACATGCCAGGTTGTTCAGTTCAACCGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTCGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatatttttttAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGNGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGANCGGCGTGACTGGAAATGGTGCAGACTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATGCACAATATTAAATAAGTAGGCCCTNNTTATAAGAGCCTGTTTTATTAGTGGNGGAAAAAACAGTTCACTACAGGGGAATTCTATGTCACNCTCTTTATTTNTNTAGACATTTTTAGGGNNNATTNNGAAANATTTACCCNTT
  5   1   2       bld Tad2                            IMAGE:6931171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTTGTTCAGTTCAACAGACTGCCTTTGGTTGTAAGCTTCATTGCAAGTAGTGATGCCAACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTATGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatattttttAAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCAGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCCTCTTTATTTGTATAGACATTTTTAGGGGTTAATATGTATGAAAATAATTTACCCCTTTAATTGAATTATGCCACTTACCAAAATCCCTTTTTGTAAAATGGAACTAAGAAAGGGCC
  5   1   2       bld Ga18      in                      xlk118m21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACAGGCCTCCTTCTCAGCTTAAATGAAGAGCTTGGGGACTTGTTTGAAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatatttttttAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGNTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAANATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAANANTCNACTGTGTGCNTNNTTTTANGAAAGCTNNTTTTCCT
  3   1   2       bld Ga18      in                      xlk118m21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNNGGACCTNNNTTGANNNANNTCANATGCAGTGGAAATCNAAGANNNAANAATNCTATTTNAGTTCTATACTNNANTNCCNATAGATGTTAGNAGGGATGTGTTTAGNTCCGGAGCTGNCCTTTACANNNCCCCTGNACATGCAGAANAACNTCACCTNCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCNNNTNCCCCTCACCCCTTTTTnATATATATTTTTTTAANTTTCAGTTATATAGGCACACCCCAAAAGCTNCCACCCTAAACACANNNCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTNCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTNNNNCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACANNAT
  5   1   2       bld Egg1                               PBX0044E04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACGAGGAGAACTTCAACATGCAGTGGAAATCTAAGAAGAAATAAATTCTATTTCAGTTCTATACTGTAATTCCCATAGATGTTAGCAGGGATGTGTTTAGGTCCGGAGCTGACCTTTACAGCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatatttttttAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGCGAATTCTATGTCACTCTCTNTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAG
  3   1   2       bld Ga18      in                      xlk143j14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCAGTNNNAATNNNNNANNAAANNNNNCTNTTTCAGTNCTATACTGNANTCCNATAGATNTAGNAGGGATGTGTTTAGGTNNGNNGCTGACNTTTACANNNCCCCTGNACNTGCAGANNACNTNNCCTGCACTAGGCATGTTTCATCACTTCCNNATTTATTTTNCTTTCTGAATCGCAAAGATGGGCCGTNTNCCCCTCNCCCCTTTTTnATATATATTTTTTTAANTTTCAGTTATATAGNNACACCCCAAAAGCTNNCACCCTAAACACAGNNCCTTTGGNGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCAGACTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATGCACAATATTAAATAAGTAGNNCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACAGTTCACTACAGGGGAATTCTATGTCACGCTCTTTATTTGTATAGACATTTTTAGGGTTATATTTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATNCGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGGTTAAGAGGGTCCTGCGCAATACAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTATTTTTTTCGATAGTTTCAAAAAAAGATTTGCATATATATACATTTAAGTACAATCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGAT
  5   1   2       bld Egg4                   IMAGE:3743928-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCCCCTGAACATGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatatttttttAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTtaataagataatatataaatacagggtacatataattcatatatGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTA
  5   1   2       bld Egg4      in                    IMAGE:3743928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGAATAACATCACCTGCACTAGGCATGTTTCATCACTTCCACATTTATTTTACTTTCTGAATCGCAAAGATGGGCCGTGTACCCCTCACCCCttttttatatatatttttttAAATTTCAGTTATATAGGCACACCCCAAAAGCTGCCACCCTAAACACAGGCCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGGTGCCGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTNTATTTGTATAGACATTTTTAG
  3   1   2       bld FaBN 5g3  in                    IMAGE:8076246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTATATCGGCACCCCCAAAAGCTCCACCCTAAACACAGGCCTTTGGCGCAATTATATAAATATGGCCCTGGATGTTAGGCATTGGTCATACGAGACCGGCGTGACTGGAAATGCTGCGGGCTACACCCCCTTACTGTTGTTAATGTGCATATAAGTACTTGAAACATACAGAGTACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACTGTTCACTACAGGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGGTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACCTACAGGGCGGACNGCNCTTATATTACTTTTATTTT
  3   1   2       bld DMZ  5g3  in                         xl222e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCGCAATTATANNAAATANGGCCCTGGATGTTAGGCATGGTCATACGAGACCGGCGTGACTGGAAATGGTGCAGACTACACCCCCTTACTGNNGNTAATGTGCATATAAGTACTTGAAACATGCACAATATTAAATAAGTAGGCCCTGCTTATAAGAGCCTGTTTTATTAGTGGTGGAAAAAAACAGTTCACTACAGGGGAATTCTATGTCACGCTCTTTATTTGTATAGACATTTTTAGGGTTATATTTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGCGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGGTTAAGAGGGTCCTGCGCAATACAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTATTTTTTTCGATAGTTTCAAAAAAAGATTTGCATATATATACATTTAAGTACAATCAAACTGTAATCGTTGATACGTTACCAGGGCTGA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4963899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGAATTCTATGTCACTCTCTTTATTTGTATAGACATTTTTAGGGTTATATGTATGAAATATTTACCCTTTAATGAATATGCACTACAAATCCTTTGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAAATA
  3   1   2       bld Egg4      in                    IMAGE:3743928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTAAATGAATAGAGGGCTGTAGTGCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTCCAAACTACATCCAAAACACCCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGNTAATAATGATGAGNTGCTTTAAGGTAACACNCCAACTCTCGATATGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAAA
  5   1   2       bld Gas5      in                    IMAGE:3747976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTTCAAACCAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTtaataagataatatataatacaggtacatataattcatatatGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGAT
  5   1   2       bld Gas5      in                    IMAGE:3747904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGCCATTTGCTAAAATGTGATGCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTtaataagataatatataatacaggtacatataattcatatatGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATA
  3   1   2       bld Gas5      in                    IMAGE:3747904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAAATA
  3   1   2       bld Gas5      in                    IMAGE:3747976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTTTTTTAGCTTTTGATAAATATTCCACTGTGTGCCTACTTTTAAGAAAGCTATTTTTCCTAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGTTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAAATA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4962726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTGTATGATTACTAACAAGTATTTATAAAGCACCAGTAGGTGTATACATTGAATGTACAAACTACATTCAAAACAACCATAACTGATGAGGTTAAGAGGGTCCTACGCAATGCAGTTTACAGTATTGATGAAAAATTAAACATTTAATAAGATAATATATAATACAGGTACATATAATTCATATATGCTTAAAGAAGTTAATTTTCTAACTAATGTTAAGTCTTCAGTAATAATGATGAGTGCTTTAAGTAACACCCAACTCTCGATAGTTTCAAAAAAGGATTTCAAACTGTAATCGTTGATACGTTACAGGGCTTGACAGTGACATGATATTAAAGCTGGTTTGATTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)