Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8532332.3                       9 END     4          33       44                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012774733 Xl3.1-xl234f06.5 - 12 ESTs
                                                                       ......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl234f06.5                                                                                                                                         CAGGAGGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTGGGGGGGGCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGGCAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAGATGTTTTTGTATGCAGTGTGAAGGACAATCTTTTCTTCCTAAAGGCCATCAAGAGGCTCGTCAGTGAAGCCAACTGCAACATCAAGATCTGCTTCCAGGATGTGAACCGTGGAGACCGTTGGATGCAGGATGAGATTGAATTTGGGTACATCCATGCTCCGCACAAGAGCTTCCCTGTGGTGCTGGACTCGCCACGAGACCGGGGGCTGAAGGATTTTCCTGTCCGGAATCTGCTGGGTCCGGACTTTGGATACGTGACTAAACTTGCAGCCTCTTCCGAAGTGACCAGCC
                                                  Xl3.1-CHK-1012693724                                                                                                                                               GCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTGGGGGGGGCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGGCAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAGATGTTTTTGTATGCAGTGTGAAGGACAATCTTTTCTTCCTAAAGGCCATCAAGAGGCTCGTCAGTGAAGCCAACTGCAACATCAAGATCTGCTTCCAGGATGTGAACCGTGGAGACCGTTGGATGCAGGATGAGATTGAATTTGGGTACATCCATGCTCCGCACAAGAGCTTCCCTGTGGTGCTGGACTCGCCACGAGACCGGGGGCTGAAGGATTTTCCTGTCCGGAATCTGCTGGGTCCGGACTTTGGATACGTGACTAAACTTGCAGCCTCTTCCGAAGTGACCAGCCTGGACT
                                                      consensus depths                                                                                                                                              4     4     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     7     8     8     9     8     9     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     7     7     8     6     8     6     8     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     5     4     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG      32    1099                                                                                                                                         
                                               BLH MIN      32     144                                                                                                                                         
                                               BLH OVR      32      29                                                                                                                                         
                                               EST CLI      -1      19                                                                                                                                         
                                               ORF LNG      32       3                                                                                                                                         
                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                     PROTEIN --- Dr ==== 3e-079     NP_956406.1 Unknown (protein for MGC:66317) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 2e-122     XP_544539.2 PREDICTED: similar to Protein-arginine deiminase type II (Peptidylarginine deiminase II) (PAD-H19) [Canis familiaris] -------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 4e-123     XP_425730.2 PREDICTED: similar to peptidylarginine deiminase [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 4e-130     NP_031391.2 peptidyl arginine deiminase, type II [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN === Bt ==== 4e-132     NP_001098922.1 peptidyl arginine deiminase, type II [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-132     NP_032838.2 peptidyl arginine deiminase, type II [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 0          NP_001096490.1 hypothetical protein LOC100125112 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          NP_001080369.1 peptidyl arginine deiminase, type 2 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl234f06.5                                                                                                                                                                         ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------ATG------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Ov1  5g3  out                   IMAGE:5073815.5p                                                                                                                ATATCGTCGACCCACGCGTCCGGGGCAGGAGGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTACGATTGGCCCGCGGGCAGAGACTGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGG
  5   1   2       bld Ooc1 5g                          Ooc1-db23h11.y1                                                                                                                 GGGTCGACCCACGCGTCCGCTGGGCAGGAGGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCGGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCGATGGCTCAGATGCTCCTGTAGACAAGGGCTGATTCTATGTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAAAAATGCACACAAGGCCTCGTGGACTTGGAGCCCTAATGGGCAAGGAGCCGGTGCTCGTGTGGTGTGTGAGAAGAGAGTGTGGTTGCCG
  5   1   2       bld Ooc3 5g3  out                   IMAGE:3472956.5p                                                                                                                                        GCAGGAGGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGNGTCGTGGAGAAGAACAATCACACNAGGCCT
  5   1   2       bld DMZ  5g3  out                        xl234f06.5p                                                                                                                                        GCAGGAGGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCNTGTTCTGGGCAAGC
  5   1   2       bld Emb4 5g                IMAGE:5543044-IMAGp.IMAGp                                                                                                                                              GGCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAAATACGATTTATAGCCA
  5   1   2      seed Ov1  5g                         IMAGE:8331384.5p                                                                                                                                               GCAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTACGATTGGCCCGCGGGCAGAGACTGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGG
  5   1   2       bld Emb4 5g                         IMAGE:5543044.5p                                                                                                                                                CAGAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTATAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGGAATCTGGGAGTCTTTCACTACCCAAATACGATTTATAGCCATGTTCTGGGCAAACAAAAACTGGGTCTAACAGGCCCGCTACTCAGGAACCAATTCAGCTGGCGTGTCCTTTGTGGAAAGGTTTTGCAGTTCCCCAAATGAAACAATCTATTGGGGCGTGGGGCCTAATCCAACGCTCGGCCCTTTCCGGGGACCCTCTGGGGCGGCGGGGGCAATCCTCCCAAACCCCCCGAGTAATTTTTAACGGGTGGTG
  5   1   2       bld Ov1  5g                         IMAGE:6316924.5p                                                                                                                                                CACAGCGGACACAGGAGGGAACAAGATGCAGAAACCTCAGAACCGGACCGTGCGATTGGCCCGCGGGCAGAGACAGGAGGAGGTGTATGTGCTGGGCACCTCTATATCTATCCCTGTGCTggggggggCACCTGCTGGTTCCCAATGGTTCTCTTTGCACCACTCTCAGAATATCGAAGTCTCAGTCCTTGGTAGTGATCGAGCCCAACAGAAAGTGCTCAATGGGGAGAAGCTTTGGCCGCTGGTCCAGGAGAGTTTGGTGGAAATAAAGATGTTGGCACCGAGCGCTGAGACCAATGATGGGAAGATCACATTTGCTTATTACGGCAATGGCTCAGATGCTCCTGTAGACAAGGCTGGATTCTATTTCACTGGGGTTGAGATCTCATTGGATGTTGACGCAGACCGTGATGGGGTCGTGGAGAAGAACAATCCACACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTTCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGGCTTTTCCTACCAAAATACCATTTATAGCCATGTTTCTGGGCAAGCAGAAAACTGTTCTACAAGGCCCCGCTACTCAGGGAACCAATCCAGCTGGCAGTTCTTTTGGTGGGAAGGGTTTGCAAGTTCCCCAAATGAATTCCTTTTCAATCGGGCGTGTGGGGCCTATTCCAAAGATCAACCCCCTTTCTTGGAAGTCCAATGGGCGGGCCAT
  5   1   2       bld Ooc3                            IMAGE:3472612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAGGCCTCGTGGACTTGGGGCCCTAAGGGGCAAGGAGCCGTTCTCCTGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCCGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGGCAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAG
  5   1   2       bld Tad1                            IMAGE:6939472.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTGAACTGTGACAAGGACAGTCTGTTTGCCCGCTCCGTTGATGGGGGGGATAATATTATGATGAGCAAAGAAGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGGCAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAGATGTTTTTGTATGCAGTGTGAAGGACAATCTTTTCTTCCTAAAGGCCATCAAGAGGCTCGTCAGTGAAGCCAACTGCAACATCAAGATCTGCTTCCAGGATGTGAACCGTGGAGACCGTTGGATGCAGGATGAGATTGAATTTGGGTACATCCATGCTCCGCACAAGAGCTTTCCCTGTGGTGCTGGACTCGCCCACGAGACCGGGGGGCCTGAAAGATTTTTCCTGTCCCCGAAATCTGCCTGGGGTTCCGGGAACTTTTGGGATACCCTGAACTAAAACTTTGGCAAGCCCTTCTTTCT
  5   1   2       bld Em10                            IMAGE:8318611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATCTACTGGACATGTCCCCTATGTATCTCCGGATTCAGGGGCCCGAGAAGCTTCCCAACGGGTATCACATGCTGCTCTACATCTCTGCATCCGACTCCGGGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGGCAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAGATGTTTTTGTATGCAGTGTGAAGGACAATCTTTTCTTCCTAAAGGCCATCAAGAGGCTCGTCAGTGAAGCCAACTGCAACATCAAGATCTGCTTCCAGGATGTGAACCGTGGAGACCGTTGGATGCAGGATGAGATTGAATTTGGGTACATCCATGCTCCGCACAAGAGCTTCCCTGTGGTGCTGGACTCGCCACGAGACCGGGGGCTGAAGGATTTTCCTGTCCGGAATCTGCTGGGTCCGGACTTTGGATACGTGACTAAACTTGCAGCCTCTTCCGAAGTGACCAGCCTGGACTCATTTGGGAACCTGGAAGTCAGCTCCCCAGTAA
  5   1   2       bld Ov1       out                   IMAGE:5074125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAATCTGGGAGTCTTTCACTACCAAAATACGATTTATAGCCATGTTCTGGGCAAGCAGAAGCTGTTCTACAAGGCCCGCTACTCAGGAACCAATCAGCTGCAGTTCTTTGTGGAAGGTTTGCAGTTCCCAGATGAATCATTCAATGGGCTGGTGTCTATCAAAGTCAGCCTTCTGGAGTCCATGGGACAGGGGATCCCCGACACCCCAATATTTACAGATGTGGTCACCTTCCGCATGGCTCCTCTGATCATCACCCCAAACACCTTACAGCCCATAGATGTTTTTGTATGCAGTGTGAAGGACAATCTTTTCTTCCTAAAGGCCATCAAGAGGCTCGTCAGTGAAGCCAACTGCAATATCAAGATCTGCTTCCAGGATGTGAACCGTGGAGACCGTTGGATGCAGGATGAGATTGAATTTGGGTACATCCATGCTCCGCACAAGAGCTTCCCTGTGGTGCTGGACTCGCCACGAGACCGGGGGCTGAAGGATTTTCCTGTCCGGAATCTGCTGGGTCCGGACTTTGGATACGTGACTAAACTTGCAGCCTCTTCCGAAGTGACCAGCCTGGACTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)