Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5074443.3                       4 END     3          33       75                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:3516324.3                       4 END     1          11       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7390909.5                      20 PI      91        177      601                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012774748 Xl3.1-IMAGE:5074446-IMAGp.5 - 9 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:5074446-IMAGp.5                                     GCAAGGTTCCGTTGATCAGCAAGCCGTTGCTAGGGCGACACGCACGTGCGTGGTAAATCGTTACATGAGCGTCGATTAAACTGCAGAGAGCATCAGTCCAGCGGTGTGGTCCGCGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAAAGTTGC
                                                  Xl3.1-CHK-1012697604                                           TTCCGTTGATCAGCAAGCCGTTGCTAGGGCGACACGCACGTGCGTGGTAAATCGTTACATGAGCGTCGATTAAACTGCAGAGAGCATCAGTCCAGCxxxxxxGTCCGCGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAA
                                                      consensus depths                                          2     2     2     2     2     2     2     2     2     2     2     2     2     4     2     4     2     5     3     7     4     8     4     8     5     9     5     9     5     9     5     9     5     9     5     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     5     8     5     8     5     8     5     8     4     8     4     8     4     8     4     8     3     7     2     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                               BLH ATG     186     184                                     
                                               BLH MIN     186      51                                     
                                               BLH MPR     111      51                                     
                                               BLH OVR     186     400                                     
                                               CDS MIN     186       1                                     
                                               EST CLI      91       1                                     
                                               ORF LNG     186       5                                     
                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-007     NP_650989.2 Chibby CG13415-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Ag ---- 6e-009     XP_001688425.1 AGAP004219-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 5e-031     XP_001186678.1 PREDICTED: similar to leucine-rich protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Cf ==== 2e-040     XP_538373.2 PREDICTED: similar to Chibby protein (PKD2 interactor, Golgi and endoplasmic reticulum associated 1) (PIGEA-14) (Cytosolic leucine-rich protein) (HRIHFB2025) [Canis familiaris] =============================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 2e-047     NP_001003838.1 leucine-rich protein [Danio rerio] ===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Mm ==== 4e-048     NP_082910.1 RIKEN cDNA 1110014P06 [Mus musculus] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 7e-049     NP_001002880.1 PKD2 interactor, golgi and endoplasmic reticulum associated 1 isoform b [Homo sapiens] ==================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Bt ==== 4e-050     NP_777164.1 chibby [Bos taurus] ========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 2e-050     XP_001234193.1 PREDICTED: similar to leucine-rich protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-063     AAI67320.1 Chibby homolog 1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 2e-065     NP_001082262.1 leucine-rich protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:5074446-IMAGp.5                                                 TGA---------------TAG---------------------------------------------------------------------------------------TGA------------------------------------------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------TGA------TGATAG---------------------------ATG---------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld Oo1  5x3               IMAGE:6638179-IMAGp.IMAGp AGGTACCCCGGGGTCCCGGGAAATTCCCGCGGATACGCAAGGTTCCGTTGATCAGCAAGCCGTTGCTAGGGCGACACGCACGTGCGTGGTAAATCGTTACATGAGCGTCGATTAAACTGCAGAGAGCATCAGTCCAGCGGTGTGCAGGGATTCTGTTGTGTCCTTCCAGTGGATTGATCAACTACAGTAGTGAACTAATCTTGGACTAATCTTCAGGGAAGATGCCCTTATTCGGGAACACGTTCAGCCCaaaaaaaaGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTGCGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCAAGCAAGTGGCAATGATCCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGTAAAGATTACCGTGGAAAGTAGAAAAGCATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAAAGTTGCAGCCCACGT
  5   1   2       bld Oo1  5x3                        IMAGE:6638179.5p                                     GCAAGGTTCCGTTGATCAGCAAGCCGTTGCTAGGGCGACACGCACGTGCGTGGTAAATCGTTACATGAGCGTCGATTAAACTGCAGAGAGCATCAGTCCAGCGGTGTGCAGGGATTCTGTTGTGTCCTTCCAGTGGATTGATCAACTACAGTAGTGAACTAATCTTGGACTAATCTTCAGGGAAGATGCCCTTATTCGGGAACACGTTCAGCCCaaaaaaaaGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTGCGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCAAGCAAGTGGCAATGATCCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGTAAAGATTACCGTGGAAAGTAGAAAAGCATTTCATTATCAGAAGACTGTCAAGTGGAAAGATAAAGTTGCAGCCCACGTAAGAAAGAAAATCTTCCAGTGGATCATGTGTCTACCAGAAAAAGTGATAATTGGACAATCCAGTAATAAATGGAAAGACTTATGGACAATTTTGTTGGGGTTACCCCTAAAGTCTTTTAATTTTCAGAATTCCCCTTGAATTAATATAACAAAAGA
  5   1   2       bld Gas8 5x3               IMAGE:3516324-IMAGp.IMAGp                                                                                                            GGTTTATTTTTCCAACTTTGCAGCAACTATTATCATTTATTCAAAAGAGTTTGTGCGGGAAAGGCAGTAAGTTTGGTTGAGACAAAGCGCATAGTGAACTAATCTTCAGGGAAGATGCCCTTATTCGGGAACACGTTCAGCCCaaaaaaaaGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTTTTACTGGATATGCTCTCAGAAGCAGCAGCAGACGCCCACTTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCACAGCTTCATTTTTTTGTAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAATATAAAAGTTGCAGTCCACGTAAGAAGAAAAATCTTCCAATGAATCATGTGTCTAACAGAACAGTGATAA
  5   1   2       bld Gas8 5g3  out                   IMAGE:3516324.5p                                                                                                             GTTTATTTTTCCAACTTTGCAGCAACTATTATCATTTATTCAAAAGAGTTTGTGCGGGAAAGGCAGTAAGTTTGGTTGAGACAAAGCGCATAGTGAACTAATCTTCAGGGAAGATGCCCTTATTCGGGAACACGTTCAGCCCaaaaaaaaGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTTTTACTGGATATGCTCTCAGAAGCAGCAGCAGACGCCCACTTGAAGGAAAAAGAAATGGAGGAAATTAAAAATCTGACTGGCAGGAGGAAATGAGTT
  5   1   2       bld Ov1  5g3  out                   IMAGE:5074446.5p                                                                                                                                ATATCGTCGACCCACGCGTCCGCGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTTCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATGTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTC
  5   1   2       bld Ov1  5g3  out                   IMAGE:5074443.5p                                                                                                                                           CCACGCGTCCGCGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTTCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATGTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAAAGTTGC
  5   1   2       bld Ov1  5g3  out                   IMAGE:5074445.5p                                                                                                                                           CCACGCGTCCGCGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTTCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATGTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAAAGTTGCAGCCCACGTAAG
  5   1   2      seed Ov1  5x3               IMAGE:5074446-IMAGp.IMAGp                                                                                                                                                      CGTTACATGAGCGTCGGTTAAACTTCAGAGAGCATCAGTCCCGCGGTGTACAGTGAACTAATCTTCAGGCAAGATGCCCCTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTTCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTCTTACTGGATATGCTCTCAGAAGCGGCAGCAGACGCCCACCTGAAGGAAAAAGAAATGGAGGAAATTAAAAATGTGACTGGCAGGAGGAAATGAGTTTGTTGATAGAGATGGACAATATCTGAAATTGAGCCAATGATTCCCCCATCTGATTGGACAGATCACCAGAGCTTCATTTTTTGCAAAGATTACCGTGGAAAGTAGAAAAGTATTTCATTATCAGAAGACTGTCAAGTGGAAGATAAAA
  5   1   2       chi Neu7                                 XL036n14.5p                                                                                                                                                                            ACGAGGAGAGCATCAGTCCAGCGGTGTACAGTGAACTAATCTTCAGGGAAGATGCCCTTATTCGGGAACACGTTCAGCCCAAAAAAAGTGCCACCAAGGAAATCCGCTTCCCTGTCTAACCTGCACGCGCTGGACCGGACAACTAAAGAAGTAGAACTGGGCTTAGATTATGGTTCCCCAAATATCAATATTGCAGGCCAAAGCTTGAAATTTGAAAATGGACAGTGGATCACTGAGTCAGGGGGGACTGGATCACAGAGGGAGGTCCAAAGGCTGCGCAAAAGAAACCAGCAGCTTGAAGAAGAAAACAACTTGTTACGTGTCAAAGTTGACCTTTTACTGGATATGCTGGAAGAGACTTTATCAGAGAGGCTCAGGGGACTGACGGAAATGTTCCCTGAAAGTTTCCGAACTGTGGCTGGTACATCTTTCGACTTCTCCGTTTGTGCTGCCAAGAAGTTGTACAGCTTTTCCCGCTCAGCATTGTGGATAGGAACCACTTCATTCATGATCCTGGTTTTGCCAGTAGTGTTTGAAACAGAGAAACTGCAGATGGAGCAGCAACAACAGCTACAACAAAGACAGATACTCCTAGGCCCTTCTACTGGAATGTCCGGTCCTGTCCCTCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)