Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5511806.5                       5 END     2           9       40                CCAAT/enhancer binding protein (C/EBP), alpha [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:6875126.5                       4 END     1           4       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6875126.5                       4 PI      82          1      894                (no blast hit)
     4   0.0    0Xl3.1-xlk75a21ex.5                          3 PI      84        370      913                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012774774 Xl3.1-IMAGE:5440196.3 - 21 ESTs
                                                                       ..-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5440196.3                                                                                                                                                                                       ATCTATTCCTAGTGCAGTTGGGGAATTCTGGGAAGTTCAGTAACAGCTAGAGGGCCGCTGGTAGCACACCACATGCTATAACATTCTGGCAGTGGATATGTAAGGTCATTCATGCTAGTAAAATGATCAGGAAAATATCTGATTCTTTTTTTTTGTGTGACTGGTAGTTTAAATAGAAATTTGGAAAATTCTATTGCAGTTAAAGAAAATGTATGGGGCAGTGTTGGACAAATGCACCACAGGCCCCTGTACTGAATTAATGTTGGTTTACTAAACCAGATGAGAGACTTCCCCAGGGCCTGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGTAACATTTAAGGTTTCACAGCTTACAGGCGAGAGAGAAGCTCCACAGGGCAAAACTAAATGGAACATTATGCAAAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAATTTTTTTTTTTTAACTGTGTATATATGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCAAAAATAAACGAATAAAACAAAAAT
                                                  Xl3.1-CHK-1012689672                                                                                                                                                                                             TCCTAGTGCAGTTGGGGAATTCTGGGAAGTTCAGTAACAGCTAGAGGGCCGCTGGTAGCACACCACATGCTATAACATTCTGGCAGTGGATATGTAAGGTCATTCATGCTAGTAAAATGATCAGGAAAATATCTGATTCTTTTTTTTTGTGTGACTGGTAGTTTAAATAGAAATTTGGAAAATTCTATTGCAGTTAAAGAAAATGTATGGGGCAGTGTTGGACAAATGCACCACAGGCCCCTGTACTGAATTAATGTTGGTTTACTAAACCAGATGAGAGACTTCCCCAGGGCCTGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGTAACATTTAAGGTTTCACAGCTTACAGGCGAGAGAGAAGCTCCACAGGGCAAAACTAAATGGAACATTATGCAAAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAATTTTTTTTTTTxAxCxxxGxxTxTxTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCAAAAATAAACGAATAAAACAAAAATGTAAAA
                                                      consensus depths                                                                                                                                                                                            2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     3     6     3     6     3     6     3     6     4     8     4     8     4     8     4     8     4     8     4     8     4     8     3     8     4     8     3     8     3     9     3    11     5    11     2    12     6    12     6    12     6    12     6    12     6    12     6    12     6    12     7    12     7    12     6    12     7    12     5    11     5    11     5    11     6    11     6    11     6    11     6    11     6    10     6    10     6    10     7    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12    12    12    12    12    12    12    12    13    12    14    14    16    14    16    14    16    13    16    14    16    14    16    14    16    14    16    14    16    13    16    13    16    12    16    13    16    13    16    12    16    11    14    11    14     9    14     6    14     6    13     8    13     7    13     8    13     7    13     7    12     7    12     6    11     4     8     4     6     3     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAAGTTGTTTGGAAAACCTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGAATGAGCTAATCTCTCTGCTCCACAACATTATGCATTTCTTATGCTCATATTCTTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGCTGTCTGGCAGGGAAGGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAACACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                 Xl3.1-IMAGE:5440196.3                                                                                                                                                                                                                                      TAG------------------------------------------------------------------------ATG---------------------------------------TAG------TAG------------------------TAA---------ATG------------------------------------------TAA---------------------------------------------------------------------------------------------ATG---------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------TGA---------------------TAA---------------------------------------------TAA------------------------------------------------ATGTGAATG---TAA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------TAA------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                 ]
  5   1   1       add Ga18      in                       xlk70m07ex.5p TTNNNGCAAGAGTATTCAAATACTGCAGTATTTTACAGTTGTTTAATGCTCTCCCTGTTACCTACCCTAAGTATAGGAATGTTGCAGAGGATACAGGGTATTTTATCTTACATGTGCCTTATGAAAGTGTCTTTTGTAGAATGTGGGTGATATATGTTACTTTAGTACATTACAGAGTATTCATCTATTCCTAGTGCAGTTGGGGAATTCTGGGAAGTTCAGTAACAGCTAGAGGGCCGCTGGTAGCACACCACATGCTATAACATTCTGGCAGTGGATATGTAAGGTCATTCATGCTAGTAAAATGATCAGGAAAATATCTGATTCtttttttttGTGTGACTGGTAGTTTAAATAGAAATTTGGAAAATTCTATTGCAGTTAAAGAAAATGTATGGGGCAGTGTTGGACAAATGCACCACAGGCCCCTGTACTGAATTAATGTTGGNTTACTAAACCAGATGAGAGACTTCCCCAGGGCCTGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGTAACATTTAAGGTTTCACAGCTTACAGGCGAGAGAGAAGNTCCACAGGGCAAAACTAAATGGAACATTATGCAAAAGANATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTNNTAATCATTATTTCATGCTTTCTGNNNGTTTCTGTGACACTNNTGTNNNNTAAtttttttttttAANNAAANTTNTTTGNNAACCTNC
  5   1   2       bld Emb1                   IMAGE:6635072-IMAGp.IMAGp                                                                                                                                                                                       ATCTATTCCTAGTGCAGTTGGGGAATTCTGGGAAGTTCAGTAACAGCTAGAGGGCCGCTGGTAGCACACCACATGCTATAACATTCTGGCAGTGGATATGTAAGGTCATTCATGCTAGTAAAATGATCAGGAAAATATCTGATTCtttttttttGTGTGACTGGTAGTTTAAATAGAAATTTGGAAAATTCTATTGCAGTTAAAGAAAATGTATGGGGCAGTGTTGGACAAATGCACCACAGGCCCCTGTACTGAATTAATGTTGGTTTACTAAACCAGATGAGAGACTTCCCCAGGGCCTGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGTAACATTTAAGGTTTCACAGCTTACAGGCGAGAGAGAAGCTCCACAGGGCAAAACTAAATGGAACATTATGCAAAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAAtttttttttttAATCAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGC
  5   1   2       add Emb1                            IMAGE:6635072.5p                                                                                                                                                                                        TCTATTCCTAGTGCAGTTGGGGAATTCTGGGAAGTTCAGTAACAGCTAGAGGGCCGCTGGTAGCACACCACATGCTATAACATTCTGGCAGTGGATATGTAAGGTCATTCATGCTAGTAAAATGATCAGGAAAATATCTGATTCtttttttttGTGTGACTGGTAGTTTAAATAGAAATTTGGAAAATTCTATTGCAGTTAAAGAAAATGTATGGGGCAGTGTTGGACAAATGCACCACAGGCCCCTGTACTGAATTAATGTTGGTTTACTAAACCAGATGAGAGACTTCCCCAGGGCCTGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGGAACATTTAAGGTTTCACAGCTTACAGGCGAGAGAGAAGCTCCACAGGGCAAAACTAAATGGAACATTATGCAAAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAAtttttttttttAATCAAAGGTGTTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCCTGGGCGTTGCAGTGTGGGTTGGTAATGCCCTTTTATTTTCCAGTTGTCCAAGCCTCACTCCTTGATGGTCTGGCAAGGGGAAAGGGGTGGGGGAGTGGAATGGCCAAGTGGCAAAAAAGCCCT
  5   1   2       bld Egg1      in                    IMAGE:4677839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGATGAGACACTTCCCCAGGGCATGCATGCAGCTGAACAACTACTATGTGTGCCCTTAGTATGGGGTATTTATTCCATGAATTCAACAAGTCATTTCCCTTGTGTTTATCTGTAACATTTAAGGTTTCACAGCTTACAGTGCGAGAGAGAAGCTCCACATGGCAAAACTAAATGGAACATTATTTTTAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGATTTCTGTGACACTGTGTATATAAtttttttttttAATGAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTC
  3   1   2       bld Tad2                            IMAGE:6876007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAATACACCGGTTAACCTTATTTTTTTTAATTAAGACTTTTTGTTATAAAACTGTGTCCCAGGTGTTTTTCCCATTATATCCAGTGGACACATTTTAAAAATAGGCCTAGCCTGTTTTGCTTAATTCCATTAATTTTCCAAGGCCTTCTCGGGTGGGGTTTTTCTGGTGGACAACCGGTGGAATAAAAATTTTTTTTTTTTTTAATTCAAAGTTGTTTTGGGAAAACCCTGCAGACCAGGCAGAAATGTGAATGAGCTTAATCTCTTCTGCTCTACAACAATTATGCATTTTCTTATGCTCATTTTCTTGCCCATTGTCTCTTGGGCGTTGCAGTTTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATAT
  3   1   2       bld Ga18      in                       xlk70m07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAAGNTTCNCAGNTNACAGCGAGAGANNANCNCNCAGGGNAAACNAAATGNACATTATGNAAAGANATNCAAAATACAGNNCTTATTTTNTAACTATTGTAANCTGTCAGTTTTCATTATCATGAACNTTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACNCTGTGTATATAATTTTTTTTTTTTAATGAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACANCATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTNNNNNNGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGATNNNNNTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTNNCCNTGCAAGAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAANTCTTTTGAAACNCANNC
  5   1   2       bld Brn3                            IMAGE:8537119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACATTATGCAAAAGATATACAAAATACAGTACTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTATCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAAttttttttttttAATCAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGaaaaaaaaTATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAGTAGTGCCTTAAAGCTACTACCCG
  3   1   2       bld Ga18                             rxlk123o18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACAGGGCAAAACTAAATGGANCATTANGCAAAAGATATACNCAATACAGNNCTTATTTTATAACTATTGTAAACTGTCAGTTTTCATTGTCATGAACATTTAATAGCTGCTGTTGCTAATCATTATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAATTTTTTTTTTAATCAAAGTTGTTTGGAAAACCTGCAGNCCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCCACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTNGNNNTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGCTGTCTGGCAGGGAAGGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAACACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTCCCTGTTTTATAATTATTCTGGAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTNCCTTAAAGCTANCTACCCGTANCTTCTCCTGCTAAATTATNNCCAAAAA
  3   1   2       bld FaB       out                   IMAGE:8069862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCTGTGTGTTTTTGTGACACTGTGTAATAATTTTTTTTTTTAATCAAAGTTGTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATTTCTGCTTTATCCTAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGTTAAATTATTGGCTAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGACTATTGTATGTCTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGGCAATAATGAAATTCTTATAAACACAACCGCAANCCAAGCTNTCTTGTACTCATGGTAAG
  5   1   2       bld Ga18      in                      xlk113k06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTCNTGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAAtttttttttAATCAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCCACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCNNNNNGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGCTGTCTGGCAGGGAAGGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAACACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGaaaaaaaaTATTTTATTAAAATTATTGCAGCAGTCCCTGTTTTATAATTATTCTGGAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTNNaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk113k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTCATGCTTTCTGTGTGTTTTCTGTGACACTGTGTATATAATTTTTTTTTAATCAAAGTTGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCCACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTNNNNNTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGCTGTCTGGCAGGGAAGGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAACACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTCCCTGTTTTATAATTATTCTGGAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTANCTACCCGTANCTTCTCCTGCTAAATTATTGNCCAAAAA
  3   1   2       bld Emb4      in                    IMAGE:5440196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCGACTCACGCGTCCGGTTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCAATCCT
  5   1   2      seed Emb4      in                    IMAGE:5440196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGGAAAACCTGCAGACCAGCAGAATGTGAATGAGCTAATCTCTCTGCTCTACAACATTATGCATTTCTTATGCTCATATTCTTGCCATTGTCTCTTGGGCGTTGCAGTGTTGGTTGGTAATGCCTTTTATTTCCAGTTGTCAAGCTCACTCTGATGTCTGGCAGGGAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCAAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGaaaaaaaaTATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGttttttttggggggagttttgccttgcaaaaaaaaaGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTT
  3   1   2       bld Tbd3 5g3  out                   IMAGE:3548834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTATCAACATATGCATTTATTATGCTCATATTCTTCCCATGTCTCTGGGGCGTGCAGTGTGGTTTGGTATGCCTTTATTTCCAGTTGTCAAGCTCATTTTATGGTCTGGCAGGGAAAAGGGTGTGAGTGAATGGCAAGTGCAAAAGCACTAGTACTGTACGCNAGAGGTATCCCAGCAAAATACTTTGCACTCTTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGAAAAAAAATATTTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCAAAAATAAACGAATAAAACAAAAATGTAAAATGTTAAA
  3   1   2       bld Egg1      in                    IMAGE:4677839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCAGTTGGATATTTGGGGATGTGCTCTTCATTGTCAGTTAATAGCTGGAAAAAAAATATTTTATTAAAATTATTGCAGCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCCCATTAAGTCCCATTATACCCTTTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCCCAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTTTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTGCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAAGGTTATTGAAAATAAAAGAAATGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lens                                Lens-K007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACGCGTCCGTTGGGGATGTGCTCTTCATTGTCATTTAATAGCTGGaaaaaaaaTATTTTATTAAAATTATTGCACCAGTGACATGCCCGTAGGGCCCATGTCCCTGTTTTACAATTATTCTGCAAGTATAACTCACATTAAGTCACATTATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGtttttttttggggggagttttgccttgcaaaaaaaaaGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCaaaaataaacgaataaaacaaaaatgtaaaatgttaaaaaaaaaaaaaaa
  5   1   2       add Ga18                              xlk157o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAATTGTACCAGGGCCACGTAATAACCTCTGCAGCCACTATAGTTATGCTGCTATAATTCCTGCCATCAGTACAGTTACTGTTCTCCCCATCCTAGTATTTTGCTGAGGATGTTGGGAGTTGAAAGTCTAAAAAAAGGACTTCATGTTGGGCATCCCTGCTTTATTCAAGTAGTGCCTTAAAGCTATATACCCTTAATTTCTCCTGCTAAATTATTGGCCAAAAGAAACCCCATGtttattttttattttttttgccttgaaaaaaagatatgtatgttttaaaaatgttctggaaaataaaagaaatgCCTTTATTCACTTATTTGTTAATAATTATAATTTTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCaaaactaaataaaacaaaactttaaaataaaaaaaaaa
  3   1   2       add Ga18      out                     xlk119l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCGTNATAACCTCTGCAGNCNCTATAGTTATGCTGCTATAATTCCTGCCATCAGNACAGTNACTGTTCTCCCCATCCTAGTATTTTGCTGAGGATGTTGGGAGTTGAAAGTCTAAAAAAAGGACTNCATGTTGGGCANCCCTGCTTTATTCAAGNAGTGCCTTAAAGCTANATANCCTNAATTTCTCCTGCTAAATTATTGGCCAAAAGAANCNCCATGTTTNTTTTTTTTTTTTTTTnnCnnGAAAAAAAGATATGTATGTTTTAAAAATGTTCTGGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATTATAATTTTTTTGAAACACAnnnnnnnnnCTTGT
  5   1   2       bld Ga18      in                      xlk113h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATCAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGttttttttggggggagttttgccttgcaaaaaaaaaGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTcaaaaataaacgaataaaacaaaaatgtaaaatgttnnaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk113h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGCCACTATAGTTATGCTGCTATAATTTCCTACATNAAGCACAATTACTGTTCTCCCCATCCTAGTGATGGTGGCAGTTATAAGTCTGAAAAAAGCAGGACTTCATGTTGGGCATCTCTGCTTTATCCAAGTAGTGCCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTnCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACANANCCGCATNNCCTTGTTTTTATT
  3   1   2       bld Emb4                            IMAGE:4957113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTAAAGCTAACTACCCGTAACTTCTCCTGCTAAATTATTGGCCAAAAAGAAATCCTGTTTTTTTTGGGGGGAGTTTTCCCTTGCAAAAAAAAAGATATTGTATGTTTTAAAAATGTTATTGAAAATAAAAGAAATGCCTTTATTCACTTATTTGTTAATAATGATAATTCTTTTGAAACACAACCGCATATCCTTGTTTTTATTTTCAAAAATAACCGAATAAACCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)