Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7980933.5                       8 END     4          44       50                hypothetical protein LOC735153 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012774791 Xl3.1-XL052p05.3 - 9 ESTs
                                                                       .......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL052p05.3                                                                                                                                                                        GAATCAATGCAACGGAAGCCCTAGCACATCCATATCTTGAGGAATATAACGATTCTGATCCTGATCCACCTGCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTAATCAT
                                                  Xl3.1-CHK-1012696790                                                                                                                                                                              ATGCAACGGAAGCCCTAGCACATCCATATCTTGAGGAATATAACGATTCTGATCCTGATCCACCTGCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTAATCATTAAAAA
                                                      consensus depths                                                                                                                                                                             2     3     2     3     2     3     2     3     2     3     2     5     5     7     6     7     6     7     6     7     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     5     7
  3   1   2      seed Brn1                            IMAGE:6951403.3p GCCACAAGCCATCCACTGATCAAACAAGATGGAAAGCTCACATGCTCAAGACTATGTGAGAATGCTCCCCAAGAAACAAAAAAAGAATTTTAAGGAGCTCTTTCCAACTATGAGTTCAATAGAGACGGAACTCTTAGAGAAGATGCTGGATCTAGACCCTGAAAAAAGAATCAATGCAACGGAAGCCCTAGCACATCCATATCTTGAGGAATATAACGATTCTGATCCTGATCCACCTGCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATAGGA
  3   1   2       bld Em10 5g3  out                   IMAGE:7983165.3p                                                                                                CCTATAACAATAAAGTTTAAGAAGTTTTTCCAAATGAATACAAAGGGTGGAATTTTGATAAGATTTGAAGTGAACGAAAAAAGAATAATTTATAGAGGCTTTGCATATACTGTTTTGAGGAATATAGCGTTATGATCGTATCCACGTGAGTAGAATAGATGAATCATTGAAAGCCTGAATCAGGATTCCATGAGTGGAAAGTTTAAGTACATTGAAATAATAGACGTTTAAGCCAATGAAACAGAGCCAAGCAGCTAGTTAGTTACACAGAACAAGTTTTCCATAATAACTAGCATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCACAGTCAGGCAGAAAACATGGCGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTCAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAACGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCAGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAAATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGCTTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTGAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGGCAC
  3   1   2       bld Tbd7                                 XL052p05.3p                                                                                                                                                                      AAGAATCAATGCAACGGAAGCCCTAGCACATCCATATCTTGAGGAATATAACGATTCTGATCCTGATCCACCTGCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACACAAATATATTAATAATGTGCATATAAGCTGTNAATCATTAAAAACGNCTTAAAA
  3   1   2       bld Neu7                                 XL048b10.3p                                                                                                                                                                                                                                  CCTGATCCACCTGCAAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCACCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACATGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACCGGTCTCTCTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTATCATTAAAAACGC
  3   1   2       bld Tbd7 5g3  out                        XL101k08.3p                                                                                                                                                                                                                                   CTGATCCACCTGCCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTNAATCATTAAAAACGCTTAAAA
  5   1   2       bld Skin                            IMAGE:8642869.5p                                                                                                                                                                                                                                     CTGATCCCCTGCAGAGAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACCAGAAACTGCACGATTCACAGGCAGGCAGAAAATTGGCGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTCAGTTTATTATTTTATTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATaaaaaaaaaTGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGCTTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTGAATCGCTGTATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACACAAATATATTAATAATGTGCATATAAGCTGTTAATCATTAAAAACGCTAGAAAATAAGGaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Tbd7                                 XL096n22.3p                                                                                                                                                                                                                                         CACCTGCAGAGAAAATATGATGACTCATTTGAAAGCCTAGATCTGGATGTCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTATCATTA
  3   1   2       bld Tbd7      out                        XL053e02.3p                                                                                                                                                                                                                                                                                          TCCATGAGTGGAAAAGTTTGAGCCACATGGAAATAATGACGTTTGAGCCAATGAAACAGAGCCAAGCAGCTAGTTAACTACACAGGACTAATTCTCCATAATAACTAGTATGGGATCCACCTTCTCAGCTCTTTGGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTAATCATTAAAAACGC
  3   1   2       bld Tbd7 5g3  out                        XL089o08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACAAGAAACTGCACAATTCAGAGGCAGGCAGAAACATGGTGTCCTGACCCAAAAGAACTTGTTCATTGAGTTGAGCATTCACTGCCGATATGACTGAGTTTATTATTTTTTTATGCAAATCTTTTACTTTCTGCTGATAATGGTTTTGTTTTGTATTGTGACCTGAAACGAGGACAACATGAGAACTGAGCCGTAAGCTTCATTGGGGGGCTCCTTAGAAATAAAAAAAGATGACAAATGATATACTGTATAAAGTATATAAATATATAATTACATTGTGTAAAGTGAAAGTGTATCACAGGCAGAGGAAGACTAACCCACACACGAGTGACATCTAGTAATGTGGAGGCAACTTAATCGCTGAATCAGACGTCATCTGCAGACGGGTCTCACTGTGTGCAAAGAAGAATATGTGACCAATGCAATGTACAGAAATATATTAATAATGTGCATATAAGCTGTTAATCATTAAAAACGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)