Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7299042.5                      12 END     6          46       50                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012774804 Xl3.1-IMAGE:5516299.5 - 13 ESTs
                                                                       .-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5516299.5                                                    GGCTGGTCATGTGACAGTCAGATGACTGAGCAGCCAGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAATTACTTCTACGTGCCAGACCTGGGACAAGTCCCCGAAATAGATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGATGATCTCATGTACAGCGCTGACCTTGGGCCGGGTATTGCTCCTTCTGCACCTGGAGTTCCCATCCCTGAGCTTCCAACCTTCACCACCGAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGTCTGCTGCCACCACCACCCCCACCCCCTCCTCCTCCTCCTCCCCCACCTCCTCCTGAACCCAGTGCCCTGTCACCCCCTGCACCTCCGCCC
                                                  Xl3.1-CHK-1012693026                                                          TCATGTGACAGTCAGATGACTGAGCAGCCAGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAATTACTTCTACGTGCCAGACCTGGGACAAGTCCCCGAAATAGATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGATGATCTCATGTACAGCGCTGACCTTGGGCCGGGTATTGCTCCTTCTGCACCTGGAGTTCCCATCCCTGAGCTTCCAACCTTCACCACCGAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGTCTGCTGCCACCACCACCCCCACCCCCTCCTCCTCCTCCTCCCCCACCTCCTCCTGAACCCAGTGCCCTGTCACCCCCTGCACCTCCGCCCCCACCT
                                                      consensus depths                                                         2     2     2     2     2     2     4     5     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     8    10     8     9     8     9     7     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     2     2     2     2     2
                                               BLH ATG      84     633                                                    
                                               BLH MIN      81     150                                                    
                                               BLH MPR      75     150                                                    
                                               BLH OVR      84     889                                                    
                                               CDS MIN      84       2                                                    
                                               EST CLI      16       2                                                    
                                               ORF LNG      84      73                                                    
  5   1   2       bld Egg1 5g                            PBX0120E08.5p GGGGGCGGAGTTCAGGAAGTGATAGACTGTGAGTGGGAGAAGGAAGAGTGTGGCTGGTCATGTGACAGTCAGATGACTGAGCAGCCAGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTTCAAAGGCAGCAAGGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGG
  5   1   2       bld Ga12 5g3  out                        XL199n20.5p                                                    GGCTGGTCATGTGACAGTCAGATGACTGAGCAGCCAGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGA
  5   1   2       bld Emb4 5g                         IMAGE:5516299.5p                                                                             ACTGAGCAGCCAGCCATAAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGCTTAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTTTTGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAAATACTTCT
  5   1   2       bld Int2 5g                         IMAGE:8528658.5p                                                                                     GCCGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAACCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACATGCTGTTCATGAAAAACTGAAGTAGTTCCCAGCGTGCGTGAATACAAGAGGACAAGATGAGCATCGCGGCCAACACCGGTTGGGCACCTGCCACATAACATCCATTCGATCCGCACCTTGATTCGTTTCACAGACTAATAACTTCATAATAACACGTAGTTCTTACCCACTTGCTGTAGAGGAACTAGGATACTCATAGATTAAAGTACATATTCAAATACCATTTAATTCCCCTTAGTTTATTAAAGGATACTGTTATCAATTTAGTAAGTAATTG
  5   1   2       bld Ga12 5g3  out                        XL142j24.5p                                                                                      CAGGAAGAGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCANAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAG
  5   1   2      seed Ooc3 5g3  out                   IMAGE:3436813.5p                                                                                             AGAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTG
  5   1   2       bld Lu1  5g3  out                   IMAGE:4057407.5p                                                                                              GAGAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAAGAATACAGTTCCATTTTT
  5   1   2       bld Lu1  5g                         IMAGE:4633713.5p                                                                                                GAGACGGGGGGTGCAAGACCAGTGATCAGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCTTTAAGGTTTTTTCAATGCTTAATTTC
  5   1   2       bld Tbd7 5g3  out                        XL105b05.5p                                                                                                                           AGGCCGGGGTGAAGCAGGCACAATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTTCAGTGCTAAATATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTA
  5   1   2       bld Emb1                            IMAGE:5155645.5p                                                                                                                                                                                                                             CCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCCTGGGAGCGACAGACAGCAGAGAATTTACTTCTACGTGCCAGACCTGGGACAAGTCCCCCGAAAATAAATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGAAGATCTCATGTACAGCGCCTGACCTGGGCCCGGGTATTGCTCCTTCTGCACCTGGGAGTTCCCATCCCCTGAGCTTCCAACCTTCACCACCGAAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGGCTGGGGGGGCAACAAAAAACCCCATACCCCTCCCTACTTTGTACCTCCG
  5   1   2       bld Tail                            IMAGE:8544782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGAATACGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAATTACTTCTACGTGCCAGACCTGGGACAAGTCCCCGAAATAGATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGATGATCTCATGTACAGCGCTGACCTTGGGCCGGGTATTGCTCCTTCTGCACCTGGAGTTCCCATCCCTGAGCTTCCAACCTTCACCACCGAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGTCTGCTgccaccaccacccccaccccctcctcctcctcctccaccacctcctcctGAACCCAGTGCCCTGTCACCCCCTGCACCTCCGCCCCCACTTTGTCTATTCCTGCTCCTGCTAAGAAAGGTGG
  5   1   2       bld Lu1                    IMAGE:4056949-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAATTACTTCTACGTGCCAGACCTGGGACAAGTCCCCGAAATAGATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGATGATCTCATGTACAGCGCTGACCTTGGGCCGGGTATTGCTCCTTCTGCACCTGGAGTTCCCATCCCTGAGCTTCCAACCTTCACCACCGAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGTCTGCTGccaccaccacccccaccccctcctcctcctcctcccccacctcctcctgaacccagtgccctgtcaccccctgcacctcCGCCCCCACCTTTGTCTATTCCTGCTCCTGCTAAGAAAGGTGGCAGTGACCCTGGAGACCAAGGTGCCGTCCAGGGGGCTCCCAAAGAAGTGGTCAATCCTTCTAATGGACGGGCATCCTTGCTGGAGTCCATCCGTCAGGCAGGCGGCATTGGGAAAGCCAATCTGCGGAACGTGAAGGAGAAAAAGCTGGAGAAGAAGAAGATGAAGGAACAGGAACAAGTTGGAGCAACAGGAGGTGGCGGTGACCTGATGTCAGATCTCTTTAATAAGCTGGCAATGAGACGCAAAGGCATATCCGGAAAGGTGCCGGCCGCTGGAGAAGCAAGTGGAGACGGTCCCACAGGTGCCCTTTGCTCGCATTTCCGACACCATTCCACCGTTACCTCCACCGCATCAAGGCCTCGGGAGATGGAGATGAGGATGACTGGGAGTCTTAGCGGGGGTTTCCATCTTGAGGAAACGTTGGCCACGGATCTGTTCTGTTGTTCACCCCAAATCAAGATCAGGATGGCACATTT
  5   1   2       bld Lu1       out                   IMAGE:4056949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCATCACTAAGAGGGAGCAGCTGGAGCGACAGACAGCAGAGAATTACTTCTACGTGCCAGACCTGGGACAAGTCCCCGAAATAGATGTCCCTTACTCTCTGCCGGACCTGCTGGGAGTGGCTGATGATCTCATGTACAGCGCTGACCTTGGGCCGGGTATTGCTCCTTCTGCACCTGGAGTTCCCATCCCTGAGCTTCCAACCTTCACCACCGAGGATATAACAGAAAACTCTATAACTGATAGGCAAGATGGTCGTCTGCTGccaccaccacccccacccccTCCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)