Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6948899.5                     154 END     3          30        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6957274.3                      18 PI      77         96      825                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012774824 Xl3.1-XL428f01ex.3 - 10 ESTs
                                                                       ..-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL428f01ex.3                                                               CCCCCCACAAGGAACTGTATACTATGAGCACTTAAATAATTTAATACATATAGTTGTTATGATGGCAATTTCTAAAGAATATGCTATAAAGAAAGTGTGACAGTGCCGTTTCAGTGCCATGGGGAATTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTCTTGCCAGCA
                                                  Xl3.1-CHK-1012695481                                                                     ACAAGGAACTGTATACTATGAGCACTTAAATAATTTAATACATATAGTTGTTATGATGGCAATTTCTAAAGAATATGCTATAAAGAAAGTGTGACAGTGCCGTTTCAGTGCCATGGGGAATTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTCTTGCCAGCATTTAAT
                                                      consensus depths                                                                    2     2     2     2     2     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     5     6     5     6     6     6     6     7     6     7     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     8    10     8    10     8    10     8    10     8    10     7     9     5     9     5     9     5     9     5     9     5     8     5     8     3     7
                                                                   SNP                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
  5   1   2       bld Brn3                            IMAGE:8540963.5p GTTTTTGCCTGGTTTTAATATAGTATAACCATCTCCAAAAATAAGATGTAAGGGTGCATGccccccccACAAGGAACTGTATACTATGAGCACTTAAATAATTTAATACATATAGTTGTTATGATGGCAATTTCTAAAGAATATGCTATAAAGAAAGTGTGACAGTGCCGTTTCAGTGCCATGGGGAATTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTTACATAGGGGATATCTATTTCGATATATAGTCTATATTACATGCTGTGAGTAAGATATTCTTNGCAGACAAACCATTCTGTCATCTCTGAATGACTGATGCAGATATTGATCATAA
  5   1   2       bld Egg2                   IMAGE:3301821-IMAGp.IMAGp                                                   GGGGTGCATGccccccccACAAGGAACTGTATACTATGAGCACTTAAATAATTTAATACATATAGTTGTTATGATGGCAATTTCTAAAGAATATGCTATAAAGAAAGTGTGACAGTGCCCTTTCAGTGCCATGGGGAATTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATTAAAGCCCTGGTTTTTCTTTTaaaaaaaaaaaaaaaaaaaaaGATTCGCGGCCC
  3   1   2      seed Ga15      out                      XL428f01ex.3p                                                                                         AGCACTTAAATAATTTAATACATATAGTTGTTATGATGGCAATTTCTAAAGAATATGCTATAAAGAAAGTGTGACAGTGCCGTTTCAGTGCCATGGGGAATTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTCTTGCCAGCATTTAATGCAACACATNAT
  3   1   2       bld Ga15                               XL429f01ex.3p                                                                                             AAATAATTTTAATACATATAGTTGTTANGATGGCAATTTCTAAAGAATATGGNTATAAAGAAAGTGTGACAGTGCCGTTTCAGTGCCATGGGGAATTTAAAATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTCTTGCCAGCATTTAAT
  5   1   2       bld Skin      in                    IMAGE:8641236.5p                                                                                                                                                                                      AAAATNCCCATTTTTNNGGGATCCTCGATTGAATTGTCCCATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACCGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCGTGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAGAATATTTTGATCTATTAGATAATCTGTTAATATAACCATACTGTGCTCACAATAAGCCTGTTATTCTTTCTGCAGCATTATTGCACCATTTTCTAGACTAAATAATGTCTGTGTATaaaaaaaaaaaaaaaaaaaaaaaaGGGGCCCAGCTGAACCTAACCCGTCACTTCGCTAGGATAATA
  5   1   2       bld Skin                            IMAGE:8644116.5p                                                                                                                                                                                                  ATGGAATACTTTCATAGATAATTGTTGTATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACTGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGATATTTTGATTATTAGAATATCTGTTTATATAAACATACTGTGCTCACATAAGCCTGGTTTCTTTTaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGCTGATTCCTAGACGCGCTCACTCCGCTAATGATCTATACTAATCGATGAAGATCTGTGATTGACACCACTGAGATGAAATGTATGTGATG
  3   1   2       bld Skin      in                    IMAGE:8641236.3p                                                                                                                                                                                                                               ATTTTAATATACACAACCCTTCTCTGTAGTCCATTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACCGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCGTGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTCTTTTCTGCCAGCATTAAATGCAACACATTCTCTNANCTnnnnnnnGnCAAnnnnnnnnAGCCC
  3   1   2       bld Neu7 5g3  out                        XL048o05.3p                                                                                                                                                                                                                                                       GTAGTCCATTTTTTGGACTGAAATTTTGGAAAGCACTGGTGTGGCATACCGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGATGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCGTGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTCTTGCCAGCATTTAANTGCAACACATTTATCTAGAACTAAAATAAAAGGTCAT
  3   1   2       bld Ga12 5g3  out                        XL157g19.3p                                                                                                                                                                                                                                                          GTCCATTTTTTGNACTGAAATTTTGGAAAGCACTGGTGTGGCATACCGTATGGAGCTGTTTGTAGACATGCTGTGATGTCAGCCGGTCATAGTCTACCTTTTGGGCAGAAATTGCTGTGCATCAATTTTTACATGCTGTGGGCCAATTATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCGTGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTNATCTATTAGAATAATCTGTTTAATATAAACCATACTGGCTTCACAATAAAGCC
  3   1   2       bld Egg1                            IMAGE:3301821.3p                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGCCATACTGCAAGTTTGAGGTGTTTATGTCATCCAATGATGATGTCATGCAATGATGATGTCATACAGAGAACTCTGTGGGGCCCTTTGGCAGACTTGGGGACAATTAGTGAGGGTCAGATCAGGCCATGGGCTTCTGATTGAATGGCCGTGGTCTAAACCAAAAACTCAAGCCCTCTGTTGCGATTACATAATTTTTCTTAGACTAGGTAGAGCTATGTTAATATAACATGCAGAAAGGTGTTGGCGTGACAGTTTCTTGCATACTGGTAAAGTCTTATTGGTAACGTTTTACAATAAGGGATAATCTAATTCGAATATAATAGTCTATATTAACATGCTTGTGAGTAAGGATATTTCTTTGGCAAGACAAAACCCATTTCTGTCCATTCTCTGTAAATGGACCTGAATGCAAGAATATTTTGATCTATTAGAATAATCTGTTTAATATAAACCATACTGTGCTTCACAATAAAGCCCTGGTTTTCTTTTAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)