Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012775099 Xl3.1-IMAGE:3301661-IMAGp.5 - 16 ESTs
                                                                       ....-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3301661-IMAGp.5                                                                                                                                                                                                             CTGTTTAGCTTGGGCCTGCTGGTCGGGGGTACACGACTGGGCGCCAGGGTAGTGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGGTTGCCTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAACCCTATAGCGTGCGGGGGATGATTCAGTATAATAGAAGCAATGACTGAAAAAAAGGACGTTGCAAATTAAAATGACACACGTTTCCGGGTATATTTATGATTGGAGGTTTTTAGGCTTGTGGGTTTGTTCACACATCACATCCTTCTCACAGAGCTGTCGTCTAGTGCAGGAAGTGATGTTGCCAAGGGGAAATGGATTCCCCTTTACACGGGCTGAGTAACCTGTCACTCACCTAACAGCTATTGGAAGATACCAACGTGCCACCACAGTTTATCCACCAGTTCCTTACACTTTAC
                                                  Xl3.1-CHK-1012691073                                                                                                                                                                                                                   AGCTTGGGCCTGCTGGTCGGGGGTACACGACTGGGCGCCAGGGTAGTGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGxTxxCxTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAACCCTATAGCGTGCGGGGGATGATTCAGTATAATAGAAGCAATGACTGAAAAAAAGGACGTTGCAAATTAAAATGACACACGTTTCCGGGTATATTTATGATTGGAGGTTTTTAGGCTTGTGGGTTTGTTCACACATCACATCCTTCTCACAGAGCTGTCGTCTAGTGCAGGAAGTGATGTTGCCAAGGGGAAATGGATTCCCCTTTACACGGGCTGAGTAACCTGTCACTCACCTAACAGCTATTGGAAGATACCAACGTGCCACCACAGTTTATCCACCAGTTCCTTACACTTTACATATAG
                                                      consensus depths                                                                                                                                                                                                                  3     3     3     3     3     3     5     5     5     6     5     6     5     6     6     8     6     8     6     8     7     9     7     9     6     9     9    11     9    12     9    12     9    12     9    12     9    12     9    12     8    12     8    12     8    12     9    12    11    11    11    11    11    11    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10     8    10     8    10     8    10     8     8     7     8     7     8     4     8     4     8     4     8     4     8     4     8     4     8     5     9     5    10     5     8     4     8     4     9     4     9     4     9     4     9     3     9     3     7     3     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                 --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C--G------
                                                                       PREDICTED - Ce ---- 3e-054     NP_493241.1 predicted CDS, apolipoprotein A-I binding protein like (1N400) [Caenorhabditiselegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PROTEIN --- Os ---- 1e-059     NP_001064477.1 Os10g0377800 [Oryza sativa (japonica cultivar-group)] -----------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- At ---- 1e-059     NP_568717.2 pyridoxamine 5'-phosphate oxidase-related [Arabidopsis thaliana] ------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Gg ==== 5e-060     XP_424208.1 PREDICTED: similar to apoA-I binding protein, partial [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---- 4e-067     XP_319557.3 AGAP003324-PA [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 7e-072     NP_572604.1 CG2974-PA [Drosophila melanogaster] --------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Sp ==== 2e-085     XP_001198801.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 2e-102     NP_001002618.1 zgc:92263 [Danio rerio] -----------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PREDICTED - Cf ---- 4e-106     XP_854934.1 PREDICTED: similar to apolipoprotein A-I binding protein [Canis familiaris] ----------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---= 2e-106     NP_658985.2 apolipoprotein A-I binding protein precursor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Bt ---= 3e-107     NP_991365.1 apoliprotein A-I binding protein [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---= 1e-108     NP_659146.1 apolipoprotein A-I binding protein; apolipoprotein A-I interacting protein;apoA-I binding protein; EST AA087124 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- Xl ==== 3e-165     AAI06227.1 LOC496142 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3301661-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------TAG------ATG------------------------TAA------------------ATG------------------------TGA------------------------TGA---------------------ATG------------TAG------------------------------------------------TAG---------TGA---------------ATG---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Egg1      in                    IMAGE:3301248.5p                                                                                                                                                                                        AAATTTCGGCACAAGGGCACTCTGTTTACCTTGGGCCTGCTGGTCGGGGGTACACGACTGGGCGCACGGGTAGCGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCGCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAANNCTAGCAGGGNAANCNTTTTTNAANGGNNNCCNTTTGGGNNCCCGGGGN
  5   1   2       bld Te2                             IMAGE:7211739.5p                                                                                                                                                                                                 GGGCTCCGCACTCTGTTTAGCTTGGGCCTGCTGGTCGGGGGTACACGACTGGGCGCCAGGGTAGTGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAATCAGCCGTGCACTTCATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTTAGGCACTAGAGAAAAAAGTACAACCTCATCTCCC
  5   1   2       bld Te2N      in                    IMAGE:7203275.5p                                                                                                                                                                                                        GCACTCTGTTTAGCTTGGGCCTGCTGGTCGGGGGTACACGACTGGGCGCCAGGGTAGTGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAATCAGCCGTGCACTTTCATGGGCGCTACCACTTCCCNTGGGTGGAAGATTTGTCCCTAAAGCACTAGAGAAAAAAGTACAACCTCAATCTTCCAC
  5   1   2       bld Egg1                               PBX0111E10.5p                                                                                                                                                                                                                                       CACGAGGCGACTGGGCGCACGGGTAGCGCAAGTTGGAGCCCTTGGCGAGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCGCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGC
  5   1   2       bld Te2N                            IMAGE:7203888.5p                                                                                                                                                                                                                                       GGGTACACGACTGGGCGCCAGGGTAGTGCAAGTTGGAGCCCTTGGCGGGACGTGTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACGGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATCCCGTCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAACAATCAGCCGTGCACTTTCATGGGCGCTACCACTCCCTGGGTGGAAGATTTTGTCCTANGCACTAGAGAAAAAAGTACACCTCATATCCCAACATACCCTGGGACTGAANTGTGTCCAGAAGTTTGCCTAAAAACCCAAATAGGGTTTCTTTGGTATTTTGTACCCATTCATGTTTTTATTAAATT
  5   1   2       bld Neu7      in                         XL022o12.5p                                                                                                                                                                                                                                                             CCCCTTAGTGTAGCCTGCTGGCACGTGGGTATGTTTAGCAAATAGTACAATTTAGTCTGGAATTTAGTGTAAGCATATGGGGTGTTATGGGTCATTTCACATCAAGGATGATTCCAATAGGCTGCTGTTCAGTAGTCGTGCACACAGCCTGTGGGTCATATGAAAAACATACGCCGTTTTATCTGAAGACTCCAAAGTTTTTATAACATCTATTAAATTGGTTTCCATTATCTATAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACGGTATTGGTGGTGTGTGGTCCTGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCAAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGTATGGAAAACCCAACAACAAGTGGGAAAGGATA
  5   1   2       chi Egg1                               PBX0057D04.5p                                                                                                                                                                                                                                                                                          GTGCGCGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCATGAGGAAGCGCAAGCAGTGGATGAAGATCCTGTCTCCGGGCGGCCATGCAGAGCACAACGGACAGCCCTACTGCCATAACGCCTTGCGTACTGAGCACTATTACGAACGCCTATGCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAAGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGA
  5   1   2      seed Egg2                   IMAGE:3301661-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                 CGGGGTCAGGGACTGGCAGGAGACGGAAGCTCTGGGTGCAGACACTACAGAAGTGGGTCAGCCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCGCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGGACTGAATGTGTCCAGAAGTTGCCTTAAAAACCAAATAGGGTTCTTGGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATaaaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  3   1   2       bld Te2N      in                    IMAGE:7203275.3p                                                                                                                                                                                                                                                                                                                          NGGAGCTCTGGTGCAGACACTACAGAAGTGGTTCAGCCACATCGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAAAAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGACTGAATGTGTCCAGAAGTTGCCTAAAAACCAAATAGGGTTCTTGGTATTGAGCCAATCAGTATCAAAAAGTCAGGN
  5   1   2       bld Te2N      in                    IMAGE:7203676.5p                                                                                                                                                                                                                                                                                                                                                              CCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACGGTATTGGTGGTGTGTGGTCCTGGAAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATCCCGTCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAACAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATATCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGTTGCCTTAAAAACCAATAGGGTTCTTGGTANTTGTAGCCAATCATNGTTATCAATATAAAGTCTTTATCATaaaaaaaaaaaaaaaaaaaaaaaaGGG
  3   1   2       bld Te2N      in                    IMAGE:7203676.3p                                                                                                                                                                                                                                                                                                                                                              CCAACATGGCAGGGGGTCTGAAATATCTGAGTCAGGAGGAAGCCCAGGCAGTGGATGAAGAGCTGTTTAATGAATATAAGTTCAGTGTTGACCAACTCATGGAACTAGCAGGACTTAGCTGCGCTGTCGCTATAACCAAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACGGTATTGGTGGTGTGTGGTCCTGGAAACAACGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATCCCGTCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATACAGCCCGACATGCTTATTTCGCTGACTGCTCCCAAACAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATATCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGTTGCCTAAAAACCAAATAGGGTTCTTGTATTGTGCCAATCAGTATCAAAGATCCA
  5   1   2       bld Neu7      in                         XL026l08.5p                                                                                                                                                                                                                                                                                                                                                                           ATTCCAATAGGCTGCTGTTCAGTAGTCGTGCACACAGCCTGTGGGTCATATGAAAAACATACGCCGTTTTATCTGAAGACTCCAAAGTTTTTATAACATCTATTAAATTGGTTTCCATTATNTATAGGCCTATCCAGTCAGTTCATTCACATCAAACTTGCCAACGGTATTGGTGGTGTGTGGTCCTGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCAAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGTATGGAAAACCCAACAACAAGTGGGAAAGG
  3   1   2       bld Egg1                            IMAGE:3301661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAACAGTATTGGTGGTGTGTGGTCCTGGGAACAACGGAGGAGATGGTNTGGTCTGTGCCCGACACCTCAAGCTTTTTGGCTATGAACCAGCTATACATTACCCGAAGCGCCCAAACAAGACGTTATTTGAAAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTCTCTCAGAGTTTCCACGTGAGCCCGAAGTAATCGATGGAGCCTATAACCTGGTTGTGGATGCCATTTTTGGATTCAGCTTTAAAGGGGCCGTGCGAGAGCCCTTTGGGAATATTCTGAGTACTTTGAAGCGCGTCACTGTACCCATCGCAAGTGTGGACATTCCATCAGGATGGGACGTGGAGAAGGGGAACTCAGAGGGGATTCAGGCCCAACATGCTTATTTCGCTGACTGCTCCCAAAAAATCAGCCGTGCACTTCAATGGGCGCTACCACTTCCTGGGTGGAAGATTTGTCCCTAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGACTGAATGTGTCCAGAAGTTGCCTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAAAAA
  3   1   1       add Neu7      in                         XL022o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGGCACTAGAGAAAAAGTACAACCTCAATCTCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGTTGCCTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAACCCTATAGCGTGCGGGGGATGATTCAGTATAATAGAAGCAATGACTGAAAAAAAGGACGTTGCAAATTAAAATGACACACGTTTCCGGGTATATTTATGATTGGAGGTTTTTAGGCTTGTGGGTTTGTTCACACATCACATCCTTCTCACAGAGCTGTCGTCTAGTGCAGGAAGTGATGTTGCCAAGGGGAAATGGATTCCCCTTTACACGGGCTGAGTAACCTGTCACTCACCTAACAGCTATTGGAAGATACCAACGTGCCACCACAGTTTATCCACCAGTTCCTTACACTTTACATATAGTTTTCCTTTAAAGTGGCCATACACAGGTTGAAAGAAGCGCGCCCTTCGCTTCACCAGACCAAGTTATCATTTCCTATCCTGTGTATGGGGGGCAATGGTCTGCCCAATAGCATATTGTGCAGGTTTGAAAATAGCATTGAGAGGTCGAGTTTGCACATGGGGGGCCAAATCAGGAAATTGATCGCTGTGCTTGCAAGGCACTTAACTA
  3   1   1       add Neu7      in                         XL026l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTACAACNTCAATCTCCCACAATACCCTGGGACTGAGTGTGTCCAGAAGTTGCCTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAACCCTATAGCGTGCGGGGGATGATTCAGTATAATAGAAGCAATGACTGAAAAAAAGGACGTTGCAAATTAAAATGACACACGTTTCCGGGTATATTTATGATTGGAGGTTTTTAGGCTTGTGGGTTTGTTCACACATCACATCCTTCTCACAGAGCTGTCGTCTAGTGCAGGAAGTGATGTTGCCAAGGGGAAATGGATTCCCCTTTACACGGGCTGAGTAACCTGTCACTCACCTAACAGCTATTGGAAGATACCAACGTGCCACCACAGTTTATCCACCAGTTCCTTACACTTTACATATAGTTTTCCTTTAAAGTGGCCATACACAGGTTGAAAGAAGCGCGCCCTTCGCTTCACCAGACCAAGTTATCATTTCCTATCCTGTGTATGGGGGGCAATGGTCTGCCCAATAGCATATTGTGCAGGTTTGAAAATAGCATTGAGAGGTCGAGTTTGCACATGGGGGGCCAAATCAGGAAATTGATCGCTGTGCTTGCAAGGCACTTAACTATCAGCAAATAAAGCA
  3   1   1       add Egg1      in                    IMAGE:3301248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACTGAATGTGTCCAGAAGTTGCCTTAAAAACCAAATAGGGTTCTTGGTATTTGTAGCCAATCATGTTTATCAATATAAAGTCTTTATCATAACCCTATAGCGTGCGGGGGATGATTCAGTATAATAGAAGCAATGACTGAAAAAAAGGACGTTGCAAATTAAAATGACACACGTTTCCGGGTATATTTATGATTAGAGATTTTTAGGCTTGTGGATTTGTGCACACATCACATCCTTCTCACAGAGCTGTCGTCTAGTGCAGGAAGTGATGTTTCCAAGGAGAAATGGATTCCCCTTTACACGGGCTAAGTAACCTGTCACTCACCTAACAGCTATTGGAAGATACCAACGTGGCACCACAGTTTATCCACCAGTTCCTTACACTTTACATATAGTTTGGTTAAAGGAAATCTATACCCCCAACCAATGTAGGTCTCTATAAAAAGATATTGCATAAAACAGCTCTTGTGTATAATACTGCTTCATGTAAATAACCATTTTCATAATAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)