Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6880437.3                       8 END     2          18       25                MGC82638 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4055636-IMAGp.5                16 PI      93          1      584                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8070608.3                      13 PI      95        939     1284                MGC82638 protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:6880437.3                       8 PI      100      1097     1284                MGC82638 protein [Xenopus laevis]
     5   0.0    0Xl3.1-IMAGE:8460128.5                       4 PI      93         60     1269                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012775149 Xl3.1-IMAGE:7978095.5 - 11 ESTs
                                                                       ...-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7978095.5                                                                AAGGGTCTGATACAGAAGGTCACAGACTATGTTATGTCCGTGCCATTTGTCCGCCAACAAATCTACAACACCGTGGAGAAAAAAGTGAAAAAACAGACAAAGGGGCTTTACCCTGCCCCCCTCAAGATTATTGAGGTGGTAAAGACTGGGCTGGATCAGGGGCAGGAGGCCGGCTATCTTGCTGAGGCACAGAAATTTGGTGAGCTTGGGATGACCTCAGAGTCCAAAGCACTAATTGGGCTGTACCATGGACAGGTTCTTTGTAAGAAGAATAAGTTTGGCACCCCGGAAAGACCAGTGCAGAAATTGGCTATACTTGGGGCTGGTCTTATGGGAGCTGGCATTGCTCAGGTGTCCGTGGATAAAGGTTTAAAGACCATTCTAAAGGACACAACCATTGAAGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGTTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAAGTTTCCTCAGATGAAGACATCCAGATGCGCCTGGTCAGTCGCTTTGTGAATGAGGCAGTGATGTGTCTG
                                                  Xl3.1-CHK-1012694493                                                                      CTGATACAGAAGGTCACAGACTATGTTATGTCCGTGCCATTTGTCCGCCAACAAATCTACAACACCGTGGAGAAAAAAGTGAAAAAACAGACAAAGGGGCTTTACCCTGCCCCCCTCAAGATTATTGAGGTGGTAAAGACTGGGCTGGATCAGGGGCAGGAGGCCGGCTATCTTGCTGAGGCACAGAAATTTGGTGAGCTTGGGATGACCTCAGAGTCCAAAGCACTAATTGGGCTGTACCATGGACAGGTTCTTTGTAAGAAGAATAAGTTTGGCACCCCGGAAAGACCAGTGCAGAAATTGGCTATACTTGGGGCTGGTCTTATGGGAGCTGGCATTGCTCAGGTGTCCGTGGATAAAGGTTTAAAGACCATTCTAAAGGACACAACCATTGAAGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGTTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAAGTTxxCxxAxxxGAxGACATCCAGATGCGCCTGGTCAGTCGCTTTGTGAATGAGGCAGTGATG
                                                      consensus depths                                                                     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     5     5     6     6     6     6     6     7     7     8     7     8     7     8     9    10     6    10     9    10     9    10     9    10     8    10     8    10     8    11     9    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     9     7     9     7     9     7     9     7     8     6     8     5     8     5     8     5     8     5     8     5     8     4     8     4     8     4     8     4     7     3     7     4     7     2     7     2     7     2     6     2     5     2     5     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
  5   1   2       add Spl                             IMAGE:8461506.5p GAAGAAGTAGCCATGGACTATGCCAGAGGAATTGCCAGGAAGAAGATCTCCTTGAAGAAAGAGAAGGGTCTGATACAGAAGGTCACAGACTATGTTATGTCCGTGCCATTTGTCCGCCAACAAATCTACAACACCGTGGAGaaaaaagtgaaaaaaCAGACAAAGGGGCTTTACCCTGCCCCCCTCAAGATTATTGAGGTGGTAAAGACTGGGCTGGATCAGGGGCAGGAGGCCGGCTATCTTGCTGAGGCACAGAAATTTGGTGAGCTTGGGATGACCTCAGAGTCCAAAGCACTAATTGGGCTGTACCATGGACAGGTTCTTTGTAAGAAGAATAAGTTTGGCACCCCGGAAAGACCAGTGCAGAAATTGGCTATACTTGGGGCTGGTCTTATGGGAGCCGGCATTGCTCAGGTGTCCGTGGATAAAGGTTTAAAGACCATTCTAAAGGACACAACCATTGAAGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGGTTTGAGACGGCCGATATGGTGATCGAGGCGGTGTTTGAGGATTAAGCATTAACATAAAGATTGCAGGAGGTGGATCTGTCGTCCCCCCACTGTATATTGCAGCACACATCGCCTCCCATCTCTCAATAGCACGCAGCAAAGCAAGAAGGATAGAGCCTATCTCCTGTGATAAGCACTGTGATATCTAGACACGCTAGACCCTGTCCTTACTCGCTACAGAGCTCTGGTAGAGCAATCCTCGTGCTGCAAGCACTCGC
  5   1   2       bld Lmb1                            IMAGE:8532096.5p                                                    CTTGAAAAAGAGAAGGGTCTGATACAGAAGGTCACAGACTATGTTATGTCCGTGCCATTTGTCCGCCAACAAATCTACAACACCGTGGAGaaaaaagtgaaaaaaCAGACAAAGGGGCTTTACCCTGCCCCCCTCAAGATTATTGAGGTGGTAAAGACTGGGCTGGATCAGGGGCAGGAGGCAGGCTATCTTGCTGAGGCACAGAAATTTGGTGAGCTTGGGATGACCTCAGAGTCCAAAGCACTAATTGGGCTGTACCATGGACAGGTTCTTTGTAAGAAGAATAAGTTTGGCACCCCGGAAAGACCAGTGCAGAAATTGGCTATACTTGGGGCTGGACTTATGGGAGCTGGCATTGCTCAGGTGTCCGTGGATAAAGGTTTAAAGACCATTCTAAAGGACACAACCATTGAAGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGTTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTA
  5   1   2       bld FaBN      out                   IMAGE:8074661.5p                                                                                                                                                                                                                                                                                                                                                                      CCAGTGCAGAAATTGGCTATACTTGGGGCTGGTCTTATGGGAGCTGGCATTGCTCAGGTGTCCGTGGATAAAGGTTTAAAGACCATTCTAAAGGACACAACCATTGAAGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGATTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAGCACAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCTGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTGGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCANGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTANGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGCTCACGTGGCTGAAGTCTGGGCAAGCTTTTGAGAGCGTTNGGGGCGGAACATGAGCTATGA
  5   1   2       bld Spl                             IMAGE:8461436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GNGATCCATCGATTCGAATTCGTCCCGGCTTAGGAAGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGTTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGGAACATTGAGCTATTGAAGCCATGGTGGCCANNAGATCTGGGCGTAATCTGGGAAAGCTTTATTCTATCACAGAGTGAGAGCGACCATACTCTGCCTGAGAATCTGAGAGTTAGCTACAGCAGCTGAGTTCTAATGAACTCAATGCTGTCTCCTGTATAGCAGATTCGCGAGACTCCTACAAAGAATGGCTGTGC
  5   1   2       bld Tad1      out                   IMAGE:6880437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGCCAGCAACAAGTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAAGGATTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCTGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTGGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCANGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTTCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGGCTGAGGATCTGGGCAAAAGCTTTTGGAGAGCGGGTTTGGGGGCGGGAAACATTTGAGCTATTGAAAAGCCATGGGTGGGCAAAGGAATTCCTGGGGGCGTAAATCTTGGGAAAAGGGCTTTTAATATCCAACCAACCAAGGAAATGAAAAACCCAACCCCATTT
  5   1   2       bld Lmb1                            IMAGE:8532299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTACAAAGGACTTAATGACAAGGTGAAGAAGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGTTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCATGGTGGCCNAAGGATTCTGGGGCGTAATCTGGGAANGCTTTATATCTATCAGCAGGAGTGAGAGCGACCCATACTCTGCCTGAGAGATCTGAGAGTTAGCTACAGCAGCTGAGTTCTCAAGAGACTCAGATCCTGTCATCCTTGTATAGCTGATTCGCGAGATCTCTACATAAGAATTGGCTGTGCTGTCCCTGTGAGCTCATCATC
  5   1   2       bld Int2                            IMAGE:8824786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCCTTGATTAGGTACGATGAAAAAAATTCGAATTCGTCCCAAATAAATAAGACAGTATCTTCTACTACCTGTTGCCACTCCAAGTAGCTGGGAGGTGCCACCTCCTTCCAGTGTCTTGGAATTATCGTCCTGGCCGCATTCAGTAAATGCAAGGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAGATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAGTTTCTCAGATGAGACATCCAGATGCGCCTGGTGAGTCGCTTTGTGATGAGCAGTGATGTGTCTGCAGAGATCCTCGCTACAGTAGAGGAAATTGGGCTGTGTTGCTGATTCCCCCTTGTCTGGGAGCCATTCGAAATAGC
  5   1   2       bld Bone                            IMAGE:8742115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAGAGTGTGACTTCCTTTGAGCGAGACAGCATTGTCACCAATCTGACGGGACAACTGGATTATAAGGGATTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCTGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTAAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAGTTTCCTCAGATGAGACATCAGATGCGCTGGTCAGTCGCTTTGTGATGAGCATGATGTGTCTGCAGAAGAATCTCGCTAACAGTAGAGAAATATGGGGCCTGTGTTGGCTGCTTCCCCCCTTGTTCTGGGGAGGCCATTTCA
  5   1   2       bld Emb9                            IMAGE:7978095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACGGGACAACTGGATTATAAGGGGTTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAGCACAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTAAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCACTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTTAAGTTACAGGCCAAGCCTGAAGTTTCCTCAGATGAAGACATCCAGATGCGCCTGGTCAGTCGCTTTGTGAATGAGGCAGTGATGTGTCTGCAGGA
  5   1   2      seed Int2                            IMAGE:8530862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACGGGACAACTGGATTATAAGGGATTTGAGACGGCCGATATGGTGATCGAGGCCGTGTTTGAGGATATAAGCATTAAACATAAAGTATTGCAGGAGGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAACTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTCAAGCTACAGGCCAAGCCTGAAGTTTCTCAGATGAGACATCCAA
  5   1   2       bld Lmb1                            IMAGE:8531872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTCCTTAATAATATTCGTCCGTGGAATCTGTCGTCCCCCCACACTGTATATTTGCCAGCAACACATCCGCCCTCCCCATCTCTCAGATAGCAGCGGCCAGCAAAAGGCCAGAGAAGGTGATAGGAATGCACTATTTCTCCCCTGTGGATAAGATGCAACTGTTGGAAATAATCACTACAGACAAAACGTCTAAGGACACCACTGCTTCTGCTGTAGCCGTCGGCCTCAAGCAGGGCAAGGTCATCATTGTGGTGAAGGATGGACCAGGATTCTACACTACCCGCTGCCTGGGCCCCATGATGGCTGAAGTCGTCCGTGTCCTGCAGGAAGGGGTAGATCCCAAGAAGCTGGACGCCCTCTCTACCGGCTTTGGTTTCCCAGTAGGGGCTTCTACTCTAGCTGATGAGGTGGGCATTGATGTGGCGGCTCACGTGGCTGAGGATCTGGGCAAAGCTTTTGGAGAGCGGTTTGGGGGCGGAAACATTGAGCTATTGAAAGCCATGGTGGCCAAAGGATTCTTGGGGCGTAAATCTGGGAAAGGCTTTTATATCTATCAGCAGGGAGTGAAGAGCCGACCCATTAACTCTGGCACTGAGGAAATACTGGAGAAGTTTAAGCTACAGGCCAAGCCTGAAGTTTCCTCAGATGAAGACATCCAGATGCGCCTGGTCAGTCGCTTTGTGAATGAGGCAGTGATGTGTCTGCAGGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)